Login to display prices
Login to display prices
C16orf58-chromosome 16 open reading frame 58 Gene View larger

C16orf58-chromosome 16 open reading frame 58 Gene

PTXBC009308

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of C16orf58-chromosome 16 open reading frame 58 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about C16orf58-chromosome 16 open reading frame 58 Gene

Proteogenix catalog: PTXBC009308
Ncbi symbol: C16orf58
Product name: C16orf58-chromosome 16 open reading frame 58 Gene
Size: 2ug
Accessions: BC009308
Gene id: 64755
Gene description: chromosome 16 open reading frame 58
Synonyms: UPF0420 protein C16orf58; RUS1 family protein C16orf58; RUS; RUS1 homolog; chromosome 16 open reading frame 58
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggctgacgacgcgggtttggagaccccgctgtgttccgagcagttcggctccggggaggcacggggctgccgcgccgccgcggacgggagcctgcagtgggaggtcgggggctggcgctggtgggggctctccagggccttcacggtcaaacctgaaggacgagatgcgggcgaagtgggggcttccggggccccctcaccgcccctctccgggctccaggccgtgttcctgcctcagggcttccctgatagcgtcagcccggactacttgccctaccagctgtgggattccgtgcaggcgtttgcttccagcctctccggctccctagccacccaggcagtcttgctgggcataggggtggggaacgcaaaagccactgtttcagctgccacggccacctggctcgtgaaagattcaactggcatgctgggccgcatcgtctttgcctggtggaaagggagcaaactggactgcaatgccaagcagtggaggctttttgcggacatcctcaatgacgtagccatgttccttgagattatggctcctgtatgcccaatctgtttcaccatgaccgtctccaccagcaacctagccaagtgcatcgtgagtgttgctggtggggccactcgggctgccctgaccgtgcaccaggctcggaggaacaacatggctgacgtgtcagccaaggacagcagccaggagacgctggtgaacctggcggggctcttggtcagcctcctgatgctccctctggtgtcaggttgccctggcttcagccttggatgtttcttcttcctcactgccctccacatctacgccaactaccgcgcggtccgagccctggtcatggagaccttgaacgaaggccggctccggctggtcctgaagcactaccttcagaggggagaggtactcgacccaactgcagccaatcgcatggagccgctgtggacaggtttctggccagctccgtctctatccctgggggtccccttacaccgcttggtctccagtgtctttgagctgcagcagctggttgaggggcaccaagaatcctacctcctctgctgggaccagtcacaaaaccaggtacaggtagttctgaaccagaaggcaggccccaagaccatcctaagggccgccacacatgggctgatgcttggggccctgcagggagatggaccccttccagcagagctggaggagctgaggaaccgggtgcgggcaggtcctaagaaagagagctgggtcgtcgtcaaggagacacacgaagtgttggacatgctgttcccaaagttcttgaaaggactgcaggatgccggctggaagaccgagaagcaccagctagaggtggatgagtggagggccacatggcttctgtctcccgaaaagaaggtcttgtga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice

30 other products in the same category: