PAAF1-proteasomal ATPase-associated factor 1 Gene View larger

PAAF1-proteasomal ATPase-associated factor 1 Gene


New product

121,50 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of PAAF1-proteasomal ATPase-associated factor 1 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about PAAF1-proteasomal ATPase-associated factor 1 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC021541
Product type: DNA & cDNA
Ncbi symbol: PAAF1
Origin species: Human
Product name: PAAF1-proteasomal ATPase-associated factor 1 Gene
Size: 2ug
Accessions: BC021541
Gene id: 80227
Gene description: proteasomal ATPase-associated factor 1
Synonyms: PAAF; Rpn14; WDR71; proteasomal ATPase-associated factor 1; WD repeat domain 71; WD repeat-containing protein 71; proteasomal ATPase associated factor 1
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggcggcgcctttgaggattcagagcgactgggcgcaagccctcaggaaggatgaaggggaggcctggctgagctgtcatcccccagggaaaccatctttgtatggcagcctgacttgtcaaggaattggcctagatggcatcccagaggttacagcttcagaaggatttactgtgaatgaaataaacaagaaaagcattcatatttcatgtccaaaggaaaatgcatcttctaagtttttggcaccatatactactttttccagaattcatacaaagagtataacatgcctggacatttccagcagaggaggtcttggtgtgtcttctagtactgacgggaccatgaaaatctggcaggcttccaatggagaactcaggagagtattggaaggacatgtgtttgatgtgaattgttgcaggtttttcccatcaggccttgtggtcctgagtgggggaatggatgcccagctgaagatatggtcagctgaagatgctagctgcgtggtgaccttcaaaggtcacaaaggaggtatcctggatacagccatcgttgatcgggggaggaatgtggtgtctgcttctcgagatgggacagcacgactttgggattgtgggcgctcaggctgcttgggagtccttgcagattgtggttcttctatcaatggagtggcggtgggtgctgctgacaactccataaaccttggctcccctgagcagatgcccagtgaacgggaggttggaacagaggccaaaatgctgctcttggcccgggaagataagaaacttcagtgcttgggactacagagcaggcagctggtgttcctctttattggctcagacgctttcaactgctgtacttttctctctggcttcttgctattggctgggactcaagatggaaacatttatcagctggatgtgaggagtccaagggctccggtacaagtcatccacagatcaggagcaccagttctatccctgctaagtgtcagagatggattcattgctagccaaggtgatggaagctgttttattgtccagcaagacttagactatgtcactgagctcactggggctgactgtgaccctgtgtacaaggtagccacatgggagaagcagatctacacatgctgtcgagacggtcttgtacgacgctaccagctttctgacctctga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - chromosome 11 open reading frame 16
- phosphorylase kinase, gamma 2 (testis)
- chromosome 6 open reading frame 199
- saccharopine dehydrogenase (putative)

Buy PAAF1-proteasomal ATPase-associated factor 1 Gene now

Add to cart