Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
Data sheet of PHKG2-phosphorylase kinase, gamma 2 (testis) Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about PHKG2-phosphorylase kinase, gamma 2 (testis) Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC002541 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | PHKG2 |
| Origin species: | Human |
| Product name: | PHKG2-phosphorylase kinase, gamma 2 (testis) Gene |
| Size: | 2ug |
| Accessions: | BC002541 |
| Gene id: | 5261 |
| Gene description: | phosphorylase kinase, gamma 2 (testis) |
| Synonyms: | serine/threonine-protein kinase PHKG2; GSD9C; phosphorylase b kinase gamma catalytic chain, liver/testis isoform; PHK-gamma-LT; PHK-gamma-T; PSK-C3; Phosphorylase kinase, gamma 2 (testis/liver); phosphorylase b kinase gamma catalytic chain, testis/liver isoform; phosphorylase kinase gamma subunit 2; phosphorylase kinase subunit gamma-2; phosphorylase kinase, gamma 2 (testis); phosphorylase kinase catalytic subunit gamma 2 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgacgctggacgtggggccggaggatgagctgcccgactgggccgccgccaaagagttttaccagaagtacgaccctaaggacgtcatcggcagaggagtgagctctgtggtccgccgttgtgttcatcgagctactggccacgagtttgcggtgaagattatggaagtgacagctgagcggctgagtcctgagcagctggaggaggtgcgggaagccacacggcgagagacacacatccttcgccaggtcgccggccacccccacatcatcaccctcatcgattcctacgagtcttctagcttcatgttcctggtgtttgacctgatgcggaagggagagctgtttgactatctcacagagaaggtggccctctctgaaaaggaaaccaggtccatcatgcggtctctgctggaagcagtgagctttctccatgccaacaacattgtgcatcgagatctgaagcccgagaatattctcctagatgacaatatgcagatccgactttcagatttcgggttctcctgccacttggaacctggcgagaagcttcgagagttgtgtgggaccccagggtatctagcgccagagatccttaaatgctccatggatgaaacccacccaggctatggcaaggaggtcgacctctgggcctgtggggtgatcttgttcacactcctggctggctcgccacccttctggcaccggcggcagatcctgatgttacgcatgatcatggagggccagtaccagttcagttcccccgagtgggatgaccgttccagcactgtcaaagacctgatctccaggctgctgcaggtggatcctgaggcacgcctgacagctgagcaggccctacagcaccccttctttgagcgttgtgaaggcagccaaccctggaacctcaccccccgccagcggttccgggtggcagtgtggacagtgctggctgctggacgagtggccctaagcacccatcgtgtacggccactgaccaagaatgcactgttgagggacccttatgcgctgcggtcagtgcggcacctcatcgacaactgtgccttccggctctacgggcactgggtaaagaaaggggagcagcagaaccgggcggctctctttcagcaccggccccctgggccttttcccatcatgggccctgaagaggagggagactctgctgctataactgaggatgaggccgtgcttgtgctgggctag |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - chromosome 6 open reading frame 199 - saccharopine dehydrogenase (putative) - sialic acid binding Ig-like lectin 6 - zinc finger, MYND-type containing 10 |