HAVCR1-hepatitis A virus cellular receptor 1 Gene View larger

HAVCR1-hepatitis A virus cellular receptor 1 Gene


New product

121,50 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of HAVCR1-hepatitis A virus cellular receptor 1 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about HAVCR1-hepatitis A virus cellular receptor 1 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC013325
Product type: DNA & cDNA
Ncbi symbol: HAVCR1
Origin species: Human
Product name: HAVCR1-hepatitis A virus cellular receptor 1 Gene
Size: 2ug
Accessions: BC013325
Gene id: 26762
Gene description: hepatitis A virus cellular receptor 1
Synonyms: CD365; HAVCR; HAVCR-1; KIM1; TIM; TIM-1; TIM1; TIMD-1; TIMD1; hepatitis A virus cellular receptor 1; T cell immunoglobin domain and mucin domain protein 1; T-cell immunoglobulin mucin family member 1; T-cell immunoglobulin mucin receptor 1; T-cell membrane protein 1; kidney injury molecule 1
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgcatcctcaagtggtcatcttaagcctcatcctacatctggcagattctgtagctggttctgtaaaggttggtggagaggcaggtccatctgtcacactaccctgccactacagtggagctgtcacatccatgtgctggaatagaggctcatgttctctattcacatgccaaaatggcattgtctggaccaatggaacccacgtcacctatcggaaggacacacgctataagctattgggggacctttcaagaagggatgtctctttgaccatagaaaatacagctgtgtctgacagtggcgtatattgttgccgtgttgagcaccgtgggtggttcaatgacatgaaaatcaccgtatcattggagattgtgccacccaaggtcacgactactccaattgtcacaactgttccaaccgtcacgactgttcgaacgagcaccactgttccaacgacaacgactgttccaatgacgactgttccaacgacaactgttccaacaacaatgagcattccaacgacaacgactgttctgacgacaatgactgtttcaacgacaacgagcgttccaacgacaacgagcattccaacaacaacaagtgttccagtgacaacaactgtctctacctttgttcctccaatgcctttgcccaggcagaaccatgaaccagtagccacttcaccatcttcacctcagccagcagaaacccaccctacgacactgcagggagcaataaggagagaacccaccagctcaccattgtactcttacacaacagatgggaatgacaccgtgacagagtcttcagatggcctttggaataacaatcaaactcaactgttcctagaacatagtctactgacggccaataccactaaaggaatctatgctggagtctgtatttctgtcttggtgcttcttgctcttttgggtgtcatcattgccaaaaagtatttcttcaaaaaggaggttcaacaactaagtgtttcatttagcagccttcaaattaaagctttgcaaaatgcagttgaaaaggaagtccaagcagaagacaatatctacattgagaatagtctttatgccacggactaa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - FYVE, RhoGEF and PH domain containing 6
- proteasomal ATPase-associated factor 1
- chromosome 11 open reading frame 16
- phosphorylase kinase, gamma 2 (testis)

Buy HAVCR1-hepatitis A virus cellular receptor 1 Gene now

Add to cart