Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
Data sheet of HAVCR1-hepatitis A virus cellular receptor 1 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about HAVCR1-hepatitis A virus cellular receptor 1 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC013325 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | HAVCR1 |
| Origin species: | Human |
| Product name: | HAVCR1-hepatitis A virus cellular receptor 1 Gene |
| Size: | 2ug |
| Accessions: | BC013325 |
| Gene id: | 26762 |
| Gene description: | hepatitis A virus cellular receptor 1 |
| Synonyms: | CD365; HAVCR; HAVCR-1; KIM1; TIM; TIM-1; TIM1; TIMD-1; TIMD1; hepatitis A virus cellular receptor 1; T cell immunoglobin domain and mucin domain protein 1; T-cell immunoglobulin mucin family member 1; T-cell immunoglobulin mucin receptor 1; T-cell membrane protein 1; kidney injury molecule 1 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgcatcctcaagtggtcatcttaagcctcatcctacatctggcagattctgtagctggttctgtaaaggttggtggagaggcaggtccatctgtcacactaccctgccactacagtggagctgtcacatccatgtgctggaatagaggctcatgttctctattcacatgccaaaatggcattgtctggaccaatggaacccacgtcacctatcggaaggacacacgctataagctattgggggacctttcaagaagggatgtctctttgaccatagaaaatacagctgtgtctgacagtggcgtatattgttgccgtgttgagcaccgtgggtggttcaatgacatgaaaatcaccgtatcattggagattgtgccacccaaggtcacgactactccaattgtcacaactgttccaaccgtcacgactgttcgaacgagcaccactgttccaacgacaacgactgttccaatgacgactgttccaacgacaactgttccaacaacaatgagcattccaacgacaacgactgttctgacgacaatgactgtttcaacgacaacgagcgttccaacgacaacgagcattccaacaacaacaagtgttccagtgacaacaactgtctctacctttgttcctccaatgcctttgcccaggcagaaccatgaaccagtagccacttcaccatcttcacctcagccagcagaaacccaccctacgacactgcagggagcaataaggagagaacccaccagctcaccattgtactcttacacaacagatgggaatgacaccgtgacagagtcttcagatggcctttggaataacaatcaaactcaactgttcctagaacatagtctactgacggccaataccactaaaggaatctatgctggagtctgtatttctgtcttggtgcttcttgctcttttgggtgtcatcattgccaaaaagtatttcttcaaaaaggaggttcaacaactaagtgtttcatttagcagccttcaaattaaagctttgcaaaatgcagttgaaaaggaagtccaagcagaagacaatatctacattgagaatagtctttatgccacggactaa |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - FYVE, RhoGEF and PH domain containing 6 - proteasomal ATPase-associated factor 1 - chromosome 11 open reading frame 16 - phosphorylase kinase, gamma 2 (testis) |