Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
Data sheet of PPAP2B-phosphatidic acid phosphatase type 2B Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about PPAP2B-phosphatidic acid phosphatase type 2B Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC009196 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | PPAP2B |
| Origin species: | Human |
| Product name: | PPAP2B-phosphatidic acid phosphatase type 2B Gene |
| Size: | 2ug |
| Accessions: | BC009196 |
| Gene id: | 8613 |
| Gene description: | phosphatidic acid phosphatase type 2B |
| Synonyms: | PPAP2B; Dri42; LPP3; PAP2B; VCIP; phospholipid phosphatase 3; PAP2 beta; lipid phosphate phosphohydrolase 3; phosphatidate phosphohydrolase type 2b; phosphatidic acid phosphatase type 2B; type-2 phosphatidic acid phosphatase-beta; vascular endothelial growth factor and type I collagen inducible |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgcaaaactacaagtacgacaaagcgatcgtcccggagagcaagaacggcggcagcccggcgctcaacaacaacccgaggaggagcggcagcaagcgggtgctgctcatctgcctcgacctcttctgcctcttcatggcgggcctccccttcctcatcatcgagacaagcaccatcaagccttaccaccgagggttttactgcaatgatgagagcatcaagtacccactgaaaactggtgagacaataaatgacgctgtgctctgtgccgtggggatcgtcattgccatcctcgcgatcatcacgggggaattctaccggatctattacctgaagaagtcgcggtcgacgattcagaacccctacgtggcagcactctataagcaagtgggctgcttcctctttggctgtgccatcagccagtctttcacagacattgccaaagtgtccatagggcgcctgcgtcctcacttcttgagtgtctgcaaccctgatttcagccagatcaactgctctgaaggctacattcagaactacagatgcagaggtgatgacagcaaagtccaggaagccaggaagtccttcttctctggccatgcctccttctccatgtacactatgctgtatttggtgctatacctgcaggcccgcttcacttggcgaggagcccgcctgctccggcccctcctgcagttcaccttgatcatgatggccttctacacgggactgtctcgcgtatcagaccacaagcaccatcccagtgatgttctggcaggatttgctcaaggagccctggtggcctgctgcatagttttcttcgtgtctgacctcttcaagactaagatgacgctctccctgcctgcccctgctatccggaaggaaatcctttcacctgtggacattattgacaggaacaatcaccacaacatgatgtag |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - solute carrier family 25, member 36 - solute carrier family 25, member 32 - immunoglobulin lambda variable 6-57 - chromosome 13 open reading frame 16 |