PPAP2B-phosphatidic acid phosphatase type 2B Gene View larger

PPAP2B-phosphatidic acid phosphatase type 2B Gene


New product

121,50 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of PPAP2B-phosphatidic acid phosphatase type 2B Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about PPAP2B-phosphatidic acid phosphatase type 2B Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC009196
Product type: DNA & cDNA
Ncbi symbol: PPAP2B
Origin species: Human
Product name: PPAP2B-phosphatidic acid phosphatase type 2B Gene
Size: 2ug
Accessions: BC009196
Gene id: 8613
Gene description: phosphatidic acid phosphatase type 2B
Synonyms: PPAP2B; Dri42; LPP3; PAP2B; VCIP; phospholipid phosphatase 3; PAP2 beta; lipid phosphate phosphohydrolase 3; phosphatidate phosphohydrolase type 2b; phosphatidic acid phosphatase type 2B; type-2 phosphatidic acid phosphatase-beta; vascular endothelial growth factor and type I collagen inducible
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgcaaaactacaagtacgacaaagcgatcgtcccggagagcaagaacggcggcagcccggcgctcaacaacaacccgaggaggagcggcagcaagcgggtgctgctcatctgcctcgacctcttctgcctcttcatggcgggcctccccttcctcatcatcgagacaagcaccatcaagccttaccaccgagggttttactgcaatgatgagagcatcaagtacccactgaaaactggtgagacaataaatgacgctgtgctctgtgccgtggggatcgtcattgccatcctcgcgatcatcacgggggaattctaccggatctattacctgaagaagtcgcggtcgacgattcagaacccctacgtggcagcactctataagcaagtgggctgcttcctctttggctgtgccatcagccagtctttcacagacattgccaaagtgtccatagggcgcctgcgtcctcacttcttgagtgtctgcaaccctgatttcagccagatcaactgctctgaaggctacattcagaactacagatgcagaggtgatgacagcaaagtccaggaagccaggaagtccttcttctctggccatgcctccttctccatgtacactatgctgtatttggtgctatacctgcaggcccgcttcacttggcgaggagcccgcctgctccggcccctcctgcagttcaccttgatcatgatggccttctacacgggactgtctcgcgtatcagaccacaagcaccatcccagtgatgttctggcaggatttgctcaaggagccctggtggcctgctgcatagttttcttcgtgtctgacctcttcaagactaagatgacgctctccctgcctgcccctgctatccggaaggaaatcctttcacctgtggacattattgacaggaacaatcaccacaacatgatgtag
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - solute carrier family 25, member 36
- solute carrier family 25, member 32
- immunoglobulin lambda variable 6-57
- chromosome 13 open reading frame 16

Buy PPAP2B-phosphatidic acid phosphatase type 2B Gene now

Add to cart