Login to display prices
Login to display prices
C13orf16-chromosome 13 open reading frame 16 Gene View larger

C13orf16-chromosome 13 open reading frame 16 Gene


New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of C13orf16-chromosome 13 open reading frame 16 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about C13orf16-chromosome 13 open reading frame 16 Gene

Proteogenix catalog: PTXBC029889
Ncbi symbol: C13orf16
Product name: C13orf16-chromosome 13 open reading frame 16 Gene
Size: 2ug
Accessions: BC029889
Gene id: 121793
Gene description: chromosome 13 open reading frame 16
Synonyms: C13orf16; bA474D23.1; testis-expressed sequence 29 protein; testis expressed 29
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggaatacgtgctggaagtgaagaactctccgcggcacctcctgaagcaattcacagtgtgtgatgttcctctgtatgacatttgtgactacaacgtctccagggaccgatgccaggagctcgggtgctgcttctacgaaggcgtctgctacaagaaagcggttcccatttacatccacgtgttctctgccttgattgtgatcatcgctggggccttcgtcatcaccatcatctacagagtcattcaggagagcaggaaagaaaaggccatccctgtggatgtcgcgctgccacagaagtccagcgaaaaggcggagttggcctcatccagcagcaagttagggctgaagcctgcgagtcctgggcctccaagtgctgggccctcgatgaagagtgacgaggataaggatgatgtaacagggacaataacagaagccgaagaaactgaggactga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice

30 other products in the same category: