C19orf57-chromosome 19 open reading frame 57 Gene View larger

C19orf57-chromosome 19 open reading frame 57 Gene


New product

121,50 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of C19orf57-chromosome 19 open reading frame 57 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about C19orf57-chromosome 19 open reading frame 57 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC012945
Product type: DNA & cDNA
Ncbi symbol: C19orf57
Origin species: Human
Product name: C19orf57-chromosome 19 open reading frame 57 Gene
Size: 2ug
Accessions: BC012945
Gene id: 79173
Gene description: chromosome 19 open reading frame 57
Synonyms: uncharacterized protein C19orf57; pre-T/NK cell associated protein (3B3); chromosome 19 open reading frame 57
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggttgtcatcgcagacctgagcacagaccccactgagctggaagagagggctctggaggtggctgggcccgatgggcaggccagtgccatatcacctgcctctcccaggaggaaggccgctgatggaggccacaggagggccttgccaggctgcacctcgctcactggggaaaccacaggagaaagtggggaggcagggcaggatggcaagccccccggcgatgtcctagtgggccctacagcctccctggctctggcacccgggagcggagagtccatgatgggtgctggagattccggtcatgcatccccggacacaggtccatgtgtcaatcagaagcaggagccaggtcctgctcaagaggaagccgagttaggtggccagaacctcgaacgagacctcgaggggttccgtgtgtccccgcaagcctctgttgtgctggaacacagagaaatagcagacgaccctctccaggagcccggggctcagcggggcattccagacaccacctcagagctggcagggcagcgagaccacctgcctcattctgcagaccagggcacctgggcagactctttagctgtggaactcgacttcctgctggacagccagatacaggatgccctggacgcctctgacttcgaagccccacctgagcagctctttccttcggggaacaagccgggcccttgctggccgggccccagctcacatgccaatggagaccctgttgcagtggccaaggcccagccgaggaccttcgtggggatccaggcctctgaggcctccaggatggaggatgccaccaacgtcgtgcgtggcctcatcgttgagctctccaacctgaaccggctgatcatgggcacccaccgggacctggaagctttcaagcgccttaactaccggaagacaaagctgggaggcaaagcccccctgccttacccttccaaggggcctgggaatatccctcgaggggacccaccctggagggagttgtag
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - Fas (TNF receptor superfamily, member 6)
- chromosome 11 open reading frame 49
- solute carrier family 25, member 40
- chromosome 18 open reading frame 22

Buy C19orf57-chromosome 19 open reading frame 57 Gene now

Add to cart