Login to display prices
Login to display prices
IGLV6-57-immunoglobulin lambda variable 6-57 Gene View larger

IGLV6-57-immunoglobulin lambda variable 6-57 Gene

PTXBC023973

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of IGLV6-57-immunoglobulin lambda variable 6-57 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about IGLV6-57-immunoglobulin lambda variable 6-57 Gene

Proteogenix catalog: PTXBC023973
Ncbi symbol: IGLV6-57
Product name: IGLV6-57-immunoglobulin lambda variable 6-57 Gene
Size: 2ug
Accessions: BC023973
Gene id: 28778
Gene description: immunoglobulin lambda variable 6-57
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggcctgggctccactacttctcaccctcctcgctcactgcacaggttcttgggccaattttatgctgactcagccgcactctgtgtcggagtctccggggaagacggtaaccatctcctgcacccgcagcagtggcagcattgccagcaactatgtgcagtggtaccagcagcgcccgggccgtgcccccaccactgtgatctatgaggataaccaaagaccctctggggtccctgatcggttctctggctccatcgacagctcctccaactctgcctccctcaccatctctggactgaagactgaggacgaggctgactactactgtcagtcttatgatagcagcaatcacacagtgctccagacccatggggaagtgagacagaaactccccagagcatctctacctgggccagtctcagcctgtctccaccggagagggtag
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice

30 other products in the same category: