IGLV6-57-immunoglobulin lambda variable 6-57 Gene View larger

IGLV6-57-immunoglobulin lambda variable 6-57 Gene


New product

113,40 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of IGLV6-57-immunoglobulin lambda variable 6-57 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about IGLV6-57-immunoglobulin lambda variable 6-57 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC023973
Product type: DNA & cDNA
Ncbi symbol: IGLV6-57
Origin species: Human
Product name: IGLV6-57-immunoglobulin lambda variable 6-57 Gene
Size: 2ug
Accessions: BC023973
Gene id: 28778
Gene description: immunoglobulin lambda variable 6-57
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggcctgggctccactacttctcaccctcctcgctcactgcacaggttcttgggccaattttatgctgactcagccgcactctgtgtcggagtctccggggaagacggtaaccatctcctgcacccgcagcagtggcagcattgccagcaactatgtgcagtggtaccagcagcgcccgggccgtgcccccaccactgtgatctatgaggataaccaaagaccctctggggtccctgatcggttctctggctccatcgacagctcctccaactctgcctccctcaccatctctggactgaagactgaggacgaggctgactactactgtcagtcttatgatagcagcaatcacacagtgctccagacccatggggaagtgagacagaaactccccagagcatctctacctgggccagtctcagcctgtctccaccggagagggtag
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - chromosome 13 open reading frame 16
- chromosome 19 open reading frame 57
- Fas (TNF receptor superfamily, member 6)
- chromosome 11 open reading frame 49

Buy IGLV6-57-immunoglobulin lambda variable 6-57 Gene now

Add to cart