TXNDC17-thioredoxin domain containing 17 Gene View larger

TXNDC17-thioredoxin domain containing 17 Gene


New product

113,40 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of TXNDC17-thioredoxin domain containing 17 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about TXNDC17-thioredoxin domain containing 17 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC006405
Product type: DNA & cDNA
Ncbi symbol: TXNDC17
Origin species: Human
Product name: TXNDC17-thioredoxin domain containing 17 Gene
Size: 2ug
Accessions: BC006405
Gene id: 84817
Gene description: thioredoxin domain containing 17
Synonyms: TRP14; TXNL5; thioredoxin domain-containing protein 17; 14 kDa thioredoxin-related protein; protein 42-9-9; testicular tissue protein Li 214; thioredoxin (Trx)-related protein, 14 kDa; thioredoxin-like 5; thioredoxin-like protein 5; thioredoxin domain containing 17
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggcccgctatgaggaggtgagcgtgtccggcttcgaggagttccaccgggccgtggaacagcacaatggcaagaccattttcgcctactttacgggttctaaggacgccggggggaaaagctggtgccccgactgcgtgcaggctgaaccagtcgtacgagaggggctgaagcacattagtgaaggatgtgtgttcatctactgccaagtaggagaaaagccttattggaaagatccaaataatgacttcagaaaaaacttgaaagtaacagcagtgcctacactacttaagtatggaacacctcaaaaactggtagaatctgagtgtcttcaggccaacctggtggaaatgttgttctctgaagattaa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - hypothetical protein LOC339047
- similar to CG4995 gene product
- S-phase kinase-associated protein 1
- cold inducible RNA binding protein

Buy TXNDC17-thioredoxin domain containing 17 Gene now

Add to cart