RPSA-ribosomal protein SA Gene View larger

RPSA-ribosomal protein SA Gene

PTXBC050688

New product

121,50 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of RPSA-ribosomal protein SA Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about RPSA-ribosomal protein SA Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC050688
Product type: DNA & cDNA
Ncbi symbol: RPSA
Origin species: Human
Product name: RPSA-ribosomal protein SA Gene
Size: 2ug
Accessions: BC050688
Gene id: 3921
Gene description: ribosomal protein SA
Synonyms: 37LRP; 67LR; ICAS; LAMBR; LAMR1; LBP; LBP/p40; LRP; LRP/LR; NEM/1CHD4; lamR; p40; 40S ribosomal protein SA; 37 kDa laminin receptor; 37/67 kDa laminin receptor; 67 kDa laminin receptor; colon carcinoma laminin-binding protein; laminin receptor 1 (67kD, ribosomal protein SA); laminin-binding protein precursor p40; multidrug resistance-associated protein MGr1-Ag; ribosomal protein SA
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgtccggagcccttgatgtcctgcaaatgaaggaggaggatgtccttaagttccttgcagcaggaacccacttaggtggcaccaatcttgacttccagatggaacagtacatctataaaaggaaaagtgatggcatctatatcataaatctcaagaggacctgggagaagcttctgctggcagctcgtgcaattgttgccattgaaaaccctgctgatgtcagtgttatatcctccaggaatactggccagagggctgtgctgaagtttgctgctgccactggagccactccaattgctggccgcttcactcctggaaccttcactaaccagatccaggcaaccttccgggagccacggcttcttgtggttactgaccccagggctgaccaccagcctctcacggaggcatcttatgttaacctacctaccattgcgctgtgtaacacagattctcctctgcgctatgtggacattgccatcccatgcaacaacaagggagctcactcagtgggtttgatgtggtggatgctggctcgggaagttctgcgcatgcgtggcaccatttcccgtgaacacccatgggaggtcatgcctgatctgtacttctacagagatcctgaagagattgaaaaagaagagcaggctgctgctgagaaggcagtgaccaaggaggaatttcagggtgaatggactgctcccgctcctgagttcactgctactcagcctgaggttgcagactggtctgaaggtgtacaggtgccctctgtgcctattcagcaattccctactgaagactggagcgctcagcctgccacggaagactggtctgcagctcccactgctcaggccactgaatgggtaggagcaaccactgactggtcttaa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - WD repeat domain 54
- WD repeat domain 76
- apolipoprotein C-II
- WD repeat domain 73

Buy RPSA-ribosomal protein SA Gene now

Add to cart