Login to display prices
Login to display prices
S100A14-S100 calcium binding protein A14 Gene View larger

S100A14-S100 calcium binding protein A14 Gene

PTXBC005019

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of S100A14-S100 calcium binding protein A14 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about S100A14-S100 calcium binding protein A14 Gene

Proteogenix catalog: PTXBC005019
Ncbi symbol: S100A14
Product name: S100A14-S100 calcium binding protein A14 Gene
Size: 2ug
Accessions: BC005019
Gene id: 57402
Gene description: S100 calcium binding protein A14
Synonyms: BCMP84; S100A15; protein S100-A14; S114; breast cancer membrane protein 84; S100 calcium binding protein A14
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgggacagtgtcggtcagccaacgcagaggatgctcaggaattcagtgatgtggagagggccattgagaccctcatcaagaactttcaccagtactccgtggagggtgggaaggagacgctgaccccttctgagctacgggacctggtcacccagcagctgccccatctcatgccgagcaactgtggcctggaagagaaaattgccaacctgggcagctgcaatgactctaaactggagttcaggagtttctgggagctgattggagaagcggccaagagtgtgaagctggagaggcctgtccgggggcactga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice

30 other products in the same category: