Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
Data sheet of CXCL10-chemokine (C-X-C motif) ligand 10 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about CXCL10-chemokine (C-X-C motif) ligand 10 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC010954 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | CXCL10 |
| Origin species: | Human |
| Product name: | CXCL10-chemokine (C-X-C motif) ligand 10 Gene |
| Size: | 2ug |
| Accessions: | BC010954 |
| Gene id: | 3627 |
| Gene description: | chemokine (C-X-C motif) ligand 10 |
| Synonyms: | IFI10; INP10; IP-10; SCYB10; crg-2; gIP-10; mob-1; C-X-C motif chemokine 10; 10 kDa interferon gamma-induced protein; chemokine (C-X-C motif) ligand 10; gamma IP10; interferon-inducible cytokine IP-10; protein 10 from interferon (gamma)-induced cell line; small inducible cytokine subfamily B (Cys-X-Cys), member 10; small-inducible cytokine B10; C-X-C motif chemokine ligand 10 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgaatcaaactgccattctgatttgctgccttatctttctgactctaagtggcattcaaggagtacctctctctagaactgtacgctgtacctgcatcagcattagtaatcaacctgttaatccaaggtctttagaaaaacttgaaattattcctgcaagccaattttgtccacgtgttgagatcattgctacaatgaaaaagaagggtgagaagagatgtctgaatccagaatcgaaggccatcaagaatttactgaaagcagttagcaaggaaaggtctaaaagatctccttaa |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - S100 calcium binding protein A13 - mitochondrial ribosomal protein 63 - S100 calcium binding protein A11 - chromosome 8 open reading frame 4 |