CXCL10-chemokine (C-X-C motif) ligand 10 Gene View larger

CXCL10-chemokine (C-X-C motif) ligand 10 Gene


New product

113,40 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of CXCL10-chemokine (C-X-C motif) ligand 10 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about CXCL10-chemokine (C-X-C motif) ligand 10 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC010954
Product type: DNA & cDNA
Ncbi symbol: CXCL10
Origin species: Human
Product name: CXCL10-chemokine (C-X-C motif) ligand 10 Gene
Size: 2ug
Accessions: BC010954
Gene id: 3627
Gene description: chemokine (C-X-C motif) ligand 10
Synonyms: IFI10; INP10; IP-10; SCYB10; crg-2; gIP-10; mob-1; C-X-C motif chemokine 10; 10 kDa interferon gamma-induced protein; chemokine (C-X-C motif) ligand 10; gamma IP10; interferon-inducible cytokine IP-10; protein 10 from interferon (gamma)-induced cell line; small inducible cytokine subfamily B (Cys-X-Cys), member 10; small-inducible cytokine B10; C-X-C motif chemokine ligand 10
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgaatcaaactgccattctgatttgctgccttatctttctgactctaagtggcattcaaggagtacctctctctagaactgtacgctgtacctgcatcagcattagtaatcaacctgttaatccaaggtctttagaaaaacttgaaattattcctgcaagccaattttgtccacgtgttgagatcattgctacaatgaaaaagaagggtgagaagagatgtctgaatccagaatcgaaggccatcaagaatttactgaaagcagttagcaaggaaaggtctaaaagatctccttaa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - S100 calcium binding protein A13
- mitochondrial ribosomal protein 63
- S100 calcium binding protein A11
- chromosome 8 open reading frame 4

Buy CXCL10-chemokine (C-X-C motif) ligand 10 Gene now

Add to cart