Login to display prices
Login to display prices
C8orf4-chromosome 8 open reading frame 4 Gene View larger

C8orf4-chromosome 8 open reading frame 4 Gene


New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of C8orf4-chromosome 8 open reading frame 4 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about C8orf4-chromosome 8 open reading frame 4 Gene

Proteogenix catalog: PTXBC020623
Ncbi symbol: C8orf4
Product name: C8orf4-chromosome 8 open reading frame 4 Gene
Size: 2ug
Accessions: BC020623
Gene id: 56892
Gene description: chromosome 8 open reading frame 4
Synonyms: protein C8orf4; TC-1; TC1; human thyroid cancer 1; thyroid cancer protein 1; chromosome 8 open reading frame 4
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgaaagcaaagcgaagccaccaagccatcatcatgtccacgtcgctacgagtcagcccatccatccatggctaccacttcgacacagcctctcgtaagaaagccgtgggcaacatctttgaaaacacagaccaagaatcactagaaaggctcttcagaaactctggagacaagaaagcagaggagagagccaagatcatttttgccatagatcaagatgtggaggagaaaacgcgtgccctgatggccttgaagaagaggacaaaagacaagcttttccagtttctgaaactgcggaaatattccatcaaagttcactga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice

30 other products in the same category: