C8orf4-chromosome 8 open reading frame 4 Gene View larger

C8orf4-chromosome 8 open reading frame 4 Gene


New product

113,40 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of C8orf4-chromosome 8 open reading frame 4 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about C8orf4-chromosome 8 open reading frame 4 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC020623
Product type: DNA & cDNA
Ncbi symbol: C8orf4
Origin species: Human
Product name: C8orf4-chromosome 8 open reading frame 4 Gene
Size: 2ug
Accessions: BC020623
Gene id: 56892
Gene description: chromosome 8 open reading frame 4
Synonyms: protein C8orf4; TC-1; TC1; human thyroid cancer 1; thyroid cancer protein 1; chromosome 8 open reading frame 4
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgaaagcaaagcgaagccaccaagccatcatcatgtccacgtcgctacgagtcagcccatccatccatggctaccacttcgacacagcctctcgtaagaaagccgtgggcaacatctttgaaaacacagaccaagaatcactagaaaggctcttcagaaactctggagacaagaaagcagaggagagagccaagatcatttttgccatagatcaagatgtggaggagaaaacgcgtgccctgatggccttgaagaagaggacaaaagacaagcttttccagtttctgaaactgcggaaatattccatcaaagttcactga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - chemokine (C-X-C motif) ligand 13
- mitochondrial ribosomal protein S6
- chromosome 1 open reading frame 2
- mago-nashi homolog B (Drosophila)

Buy C8orf4-chromosome 8 open reading frame 4 Gene now

Add to cart