Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
Data sheet of CXCL13-chemokine (C-X-C motif) ligand 13 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about CXCL13-chemokine (C-X-C motif) ligand 13 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC012589 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | CXCL13 |
| Origin species: | Human |
| Product name: | CXCL13-chemokine (C-X-C motif) ligand 13 Gene |
| Size: | 2ug |
| Accessions: | BC012589 |
| Gene id: | 10563 |
| Gene description: | chemokine (C-X-C motif) ligand 13 |
| Synonyms: | ANGIE; ANGIE2; BCA-1; BCA1; BLC; BLR1L; SCYB13; C-X-C motif chemokine 13; B-cell chemoattractant; B-cell-attracting chemokine 1; B-cell-homing chemokine (ligand for Burkitt's lymphoma receptor-1); B-lymphocyte chemoattractant; CXC chemokine BLC; b cell-attracting chemokine 1; b lymphocyte chemoattractant; chemokine (C-X-C motif) ligand 13 (B-cell chemoattractant); small inducible cytokine B subfamily (Cys-X-Cys motif), member 13 (B-cell chemoattractant); small-inducible cytokine B13; C-X-C motif chemokine ligand 13 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgaagttcatctcgacatctctgcttctcatgctgctggtcagcagcctctctccagtccaaggtgttctggaggtctattacacaagcttgaggtgtagatgtgtccaagagagctcagtctttatccctagacgcttcattgatcgaattcaaatcttgccccgtgggaatggttgtccaagaaaagaaatcatagtctggaagaagaacaagtcaattgtgtgtgtggaccctcaagctgaatggatacaaagaatgatggaagtattgagaaaaagaagttcttcaactctaccagttccagtgtttaagagaaagattccctga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - mitochondrial ribosomal protein S6 - chromosome 1 open reading frame 2 - mago-nashi homolog B (Drosophila) - S-phase kinase-associated protein 1 |