Login to display prices
Login to display prices
CXCL13-chemokine (C-X-C motif) ligand 13 Gene View larger

CXCL13-chemokine (C-X-C motif) ligand 13 Gene

PTXBC012589

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of CXCL13-chemokine (C-X-C motif) ligand 13 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about CXCL13-chemokine (C-X-C motif) ligand 13 Gene

Proteogenix catalog: PTXBC012589
Ncbi symbol: CXCL13
Product name: CXCL13-chemokine (C-X-C motif) ligand 13 Gene
Size: 2ug
Accessions: BC012589
Gene id: 10563
Gene description: chemokine (C-X-C motif) ligand 13
Synonyms: ANGIE; ANGIE2; BCA-1; BCA1; BLC; BLR1L; SCYB13; C-X-C motif chemokine 13; B-cell chemoattractant; B-cell-attracting chemokine 1; B-cell-homing chemokine (ligand for Burkitt's lymphoma receptor-1); B-lymphocyte chemoattractant; CXC chemokine BLC; b cell-attracting chemokine 1; b lymphocyte chemoattractant; chemokine (C-X-C motif) ligand 13 (B-cell chemoattractant); small inducible cytokine B subfamily (Cys-X-Cys motif), member 13 (B-cell chemoattractant); small-inducible cytokine B13; C-X-C motif chemokine ligand 13
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgaagttcatctcgacatctctgcttctcatgctgctggtcagcagcctctctccagtccaaggtgttctggaggtctattacacaagcttgaggtgtagatgtgtccaagagagctcagtctttatccctagacgcttcattgatcgaattcaaatcttgccccgtgggaatggttgtccaagaaaagaaatcatagtctggaagaagaacaagtcaattgtgtgtgtggaccctcaagctgaatggatacaaagaatgatggaagtattgagaaaaagaagttcttcaactctaccagttccagtgtttaagagaaagattccctga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice

30 other products in the same category: