Login to display prices
Login to display prices
MRPS6-mitochondrial ribosomal protein S6 Gene View larger

MRPS6-mitochondrial ribosomal protein S6 Gene

PTXBC000547

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of MRPS6-mitochondrial ribosomal protein S6 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about MRPS6-mitochondrial ribosomal protein S6 Gene

Proteogenix catalog: PTXBC000547
Ncbi symbol: MRPS6
Product name: MRPS6-mitochondrial ribosomal protein S6 Gene
Size: 2ug
Accessions: BC000547
Gene id: 64968
Gene description: mitochondrial ribosomal protein S6
Synonyms: C21orf101; MRP-S6; RPMS6; S6mt; 28S ribosomal protein S6, mitochondrial; mitochondrial ribosomal protein S6
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgccccgctacgagctggctttaatcctgaaagccatgcagcggccagagactgctgctactttgaaacgtacgatagaggccctgatggacagaggagcaatagtgagggacttggaaaacctgggtgaacgagcgcttccttataggatctctgcccacagtcagcagcacaacagaggcgggtatttcttggtggatttttatgcacccaccgcagctgttgaaagcatggtggagcacttgtctcgagatatagatgtgattagagggaatattgtcaaacaccctctgacccaggaactaaaagaatgtgaagggattgtcccagtcccactcgcagaaaaattatattccacaaagaagaggaagaagtga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice

30 other products in the same category: