Login to display prices
Login to display prices
SOCS2-suppressor of cytokine signaling 2 Gene View larger

SOCS2-suppressor of cytokine signaling 2 Gene

PTXBC010399

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of SOCS2-suppressor of cytokine signaling 2 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about SOCS2-suppressor of cytokine signaling 2 Gene

Proteogenix catalog: PTXBC010399
Ncbi symbol: SOCS2
Product name: SOCS2-suppressor of cytokine signaling 2 Gene
Size: 2ug
Accessions: BC010399
Gene id: 8835
Gene description: suppressor of cytokine signaling 2
Synonyms: CIS2; Cish2; SOCS-2; SSI-2; SSI2; STATI2; suppressor of cytokine signaling 2; CIS-2; STAT-induced STAT inhibitor 2; cytokine-inducible SH2 protein 2
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgaccctgcggtgccttgagccctccgggaatggcggggaagggacgcggagccagtgggggaccgcggggtcggcggaggagccatccccgcaggcggcgcgtctggcgaaggccctgcgggagctcggtcagacaggatggtactggggaagtatgactgttaatgaagccaaagagaaattaaaagaggcaccagaaggaactttcttgattagagatagctcgcattcagactacctactaacaatatctgttaaaacatcagctggaccaactaatcttcgaatcgaataccaagacggaaaattcagattggactctatcatatgtgtcaaatccaagcttaaacaatttgacagtgtggttcatctgatcgactactatgttcagatgtgcaaggataagcggacaggtccagaagccccccggaacggcactgttcacctttatctgaccaaaccgctctacacgtcagcaccatctctgcagcatctctgtaggctcaccattaacaaatgtaccggtgccatctggggactgcctttaccaacaagactaaaagattacttggaagaatataaattccaggtataa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice

30 other products in the same category: