NOSTRIN-nitric oxide synthase trafficker Gene View larger

NOSTRIN-nitric oxide synthase trafficker Gene


New product

121,50 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of NOSTRIN-nitric oxide synthase trafficker Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about NOSTRIN-nitric oxide synthase trafficker Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC014189
Product type: DNA & cDNA
Ncbi symbol: NOSTRIN
Origin species: Human
Product name: NOSTRIN-nitric oxide synthase trafficker Gene
Size: 2ug
Accessions: BC014189
Gene id: 115677
Gene description: nitric oxide synthase trafficker
Synonyms: DaIP2; BM247 homolog; ENOS traffic inducer; eNOS-trafficking inducer; endothelial nitric oxide synthase traffic inducer; nitric oxide synthase traffic inducer; nitric oxide synthase trafficker; ortholog of mouse disabled 2 interacting proein 2; nitric oxide synthase trafficking
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgaaatccacagcggacctgcatcaaaaacttggcaaagcaattgaattggaagcaataaaaccgacttatcaagtcctaaatgtacaagagaagaagagaaaatcacttgacaatgaagttgaaaagacagcaaatcttgtcattagcaactggaatcagcaaattaaggccaagaagaaattaatggttagtaccaagaaacatgaagcacttttccagcttgtagaaagctccaagcaatctatgactgagaaggagaagcggaagctcctcaataaactgacaaaatcaactgaaaagttggaaaaggaagatgaaaattactaccaaaaaaacatggcgggttattctaccagactgaaatgggaaaacacactagagaactgctaccagagcattctggagctggagaaggaaagaattcaacttttatgcaataacttaaaccagtacagccaacatatttctctttttggccaaaccctgaccacatgccacacgcagattcactgtgccatcagcaagattgacattgaaaaagatatccaggctgtaatggaagaaactgcaattttatctacagaaaacaaatctgagttcctgttaacggattactttgaagaagatcctaacagtgcaatggataaagagagacgaaagtctttactaaaaccaaaattattgagactgcagagagacattgaaaaagcctcaaaagacaaggaaggcctggaacgaatgcttaaaacgtactccagcacctcctccttctctgatgcaaagagccagaaagacacagcagcgttaatggatgagaacaatttgaaactagaccttttggaagcgaactcctacaaactgtcatcaatgttagcagaacttgagcaaagacctcaacccagccatccttgtagtaattccatcttcaggtggagggaaaaggagcatactcatagctatgtgaaaatatctcggccttttttaatgaagagattagagaatattgtgagcaaggcatcttctggtgggcagagcaatccaggttcttcaactccagcccctggtgcagcccagctcagcagcagactttgcaaggccttgtattcttttcaagccaggcaagatgatgagttgaatttggaaaagggtgacattgtgattatacacgagaaaaaagaagaaggatggtggtttggatctttgaatgggaaaaaaggccattttcctgccgcttatgtggaggagttaccttcaaatgctggcaacacagctacaaaggcataa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - mitochondrial ribosomal protein S5
- RELT tumor necrosis factor receptor
- farnesyltransferase, CAAX box, beta
- nuclear receptor binding protein 1

Buy NOSTRIN-nitric oxide synthase trafficker Gene now

Add to cart