MRPS5-mitochondrial ribosomal protein S5 Gene View larger

MRPS5-mitochondrial ribosomal protein S5 Gene


New product

121,50 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of MRPS5-mitochondrial ribosomal protein S5 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about MRPS5-mitochondrial ribosomal protein S5 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC014172
Product type: DNA & cDNA
Ncbi symbol: MRPS5
Origin species: Human
Product name: MRPS5-mitochondrial ribosomal protein S5 Gene
Size: 2ug
Accessions: BC014172
Gene id: 64969
Gene description: mitochondrial ribosomal protein S5
Synonyms: MRP-S5; S5mt; 28S ribosomal protein S5, mitochondrial; mitochondrial 28S ribosomal protein S5; mitochondrial ribosomal protein S5
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggcgaccgcggtgcgcgctgtgggctgcctccccgtgctgtgtagcgggacggcaggtcatttattggggaggcagtgttccctaaacaccttaccagcagcttccattttggcatggaagagtgttctcggcaatggccatttgtcatcactgggaaccagagacacccatccctacgccagcttgagccgtgcactgcagacacaatgctgtatttcttctcccagtcacctgatgagccagcagtatagaccatatagtttcttcactaaattgactgcagatgagctgtggaaaggcgctttagcagagactggtgctggagcaaaaaaaggaagaggcaaaagaactaaaaagaagaaaagaaaggatctgaacaggggtcagatcattggtgaagggcgttatggttttctatggcccggactgaatgtccctcttatgaaaaatggagcagtgcagaccattgcccaaagaagcaaggaagagcaggagaaggtggaggcagacatgatccagcagagagaagagtgggaccgaaagaagaagatgaaggttaaacgggagcgaggatggagtggaaactcatggggaggcatcagtcttggcccccctgaccctggtccctgtggagaaacatatgaggattttgataccaggatacttgaggtaagaaacgttttcactatgactgcgaaagagggaagaaagaaatcgatccgtgtcttggtggctgtggggaacggaaaaggagctgcaggtttttctattgggaaagctactgatcggatggatgctttcaggaaagcaaagaacagagcagttcaccatttgcattatatagaacgatatgaagaccatacaatattccatgatatttcattaagatttaaaaggacgcatatcaagatgaagaaacaacccaaaggttacggcctccgctgccacagggccatcatcaccatctgccggctcattggcatcaaagacatgtatgccaaggtctctgggtccattaatatgctcagcctcacccagggcctcttccgtgggctctccagacaggaaacccatcaacagctggctgataagaagggcctccatgttgtggaaatccgggaggaatgtggccctctgcccattgtggttgcgtccccccgggggcccttgaggaaggatccagagccagaagatgaggttccagacgtcaaactggactgggaagatgtgaagactgcacagggaatgaagcgctctgtgtggtctaatttgaagagagccgccacgtaa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - RELT tumor necrosis factor receptor
- farnesyltransferase, CAAX box, beta
- nuclear receptor binding protein 1
- tetratricopeptide repeat domain 12

Buy MRPS5-mitochondrial ribosomal protein S5 Gene now

Add to cart