Login to display prices
Login to display prices
S1PR1-sphingosine-1-phosphate receptor 1 Gene View larger

S1PR1-sphingosine-1-phosphate receptor 1 Gene


New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of S1PR1-sphingosine-1-phosphate receptor 1 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about S1PR1-sphingosine-1-phosphate receptor 1 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC018650
Product type: DNA & cDNA
Ncbi symbol: S1PR1
Origin species: Human
Product name: S1PR1-sphingosine-1-phosphate receptor 1 Gene
Size: 2ug
Accessions: BC018650
Gene id: 1901
Gene description: sphingosine-1-phosphate receptor 1
Synonyms: CD363; CHEDG1; D1S3362; ECGF1; EDG-1; EDG1; S1P1; sphingosine 1-phosphate receptor 1; S1P receptor 1; S1P receptor Edg-1; endothelial differentiation G-protein coupled receptor 1; endothelial differentiation, sphingolipid G-protein-coupled receptor, 1; sphingosine 1-phosphate receptor EDG1; sphingosine 1-phosphate receptor Edg-1; sphingosine-1-phosphate receptor 1
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggggcccaccagcgtcccgctggtcaaggcccaccgcagctcggtctctgactacgtcaactatgatatcatcgtccggcattacaactacacgggaaagctgaatatcagcgcggacaaggagaacagcattaaactgacctcggtggtgttcattctcatctgctgctttatcatcctggagaacatctttgtcttgctgaccatttggaaaaccaagaaattccaccgacccatgtactattttattggcaatctggccctctcagacctgttggcaggagtagcctacacagctaacctgctcttgtctggggccaccacctacaagctcactcccgcccagtggtttctgcgggaagggagtatgtttgtggccctgtcagcctccgtgttcagtctcctcgccatcgccattgagcgctatatcacaatgctgaaaatgaaactccacaacgggagcaataacttccgcctcttcctgctaatcagcgcctgctgggtcatctccctcatcctgggtggcctgcctatcatgggctggaactgcatcagtgcgctgtccagctgctccaccgtgctgccgctctaccacaagcactatatcctcttctgcaccacggtcttcactctgcttctgctctccatcgtcattctgtactgcagaatctactccttggtcaggactcggagccgccgcctgacgttccgcaagaacatttccaaggccagccgcagctctgagaagtcgctggcgctgctcaagaccgtaattatcgtcctgagcgtcttcatcgcctgctgggcaccgctcttcatcctgctcctgctggatgtgggctgcaaggtgaagacctgtgacatcctcttcagagcggagtacttcctggtgttagctgtgctcaactccggcaccaaccccatcatttacactctgaccaacaaggagatgcgtcgggccttcatccggatcatgtcctgctgcaagtgcccgagcggagactctgctggcaaattcaagcgacccatcatcgccggcatggaattcagccgcagcaaatcggacaattcctcccacccccagaaagacgaaggggacaacccagagaccattatgtcttctggaaacgtcaactcttcttcctag
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - nitric oxide synthase trafficker
- mitochondrial ribosomal protein S5
- RELT tumor necrosis factor receptor
- farnesyltransferase, CAAX box, beta