Login to display prices
Login to display prices
S100A13-S100 calcium binding protein A13 Gene View larger

S100A13-S100 calcium binding protein A13 Gene

PTXBC000632

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of S100A13-S100 calcium binding protein A13 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about S100A13-S100 calcium binding protein A13 Gene

Proteogenix catalog: PTXBC000632
Ncbi symbol: S100A13
Product name: S100A13-S100 calcium binding protein A13 Gene
Size: 2ug
Accessions: BC000632
Gene id: 6284
Gene description: S100 calcium binding protein A13
Synonyms: protein S100-A13; S100 calcium binding protein A13
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggcagcagaaccactgacagagctagaggagtccattgagaccgtggtcaccaccttcttcacctttgcaaggcaggagggccggaaggatagcctcagcgtcaacgagttcaaagagctggttacccagcagttgccccatctgctcaaggatgtgggctctcttgatgagaagatgaagagcttggatgtgaatcaggactcggagctcaagttcaatgagtactggagattgattggggagctggccaaggaaatcaggaagaagaaagacctgaagatcaggaagaagtaa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice

30 other products in the same category: