Login to display prices
Login to display prices
MRP63-mitochondrial ribosomal protein 63 Gene View larger

MRP63-mitochondrial ribosomal protein 63 Gene

PTXBC000002

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of MRP63-mitochondrial ribosomal protein 63 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about MRP63-mitochondrial ribosomal protein 63 Gene

Proteogenix catalog: PTXBC000002
Ncbi symbol: MRP63
Product name: MRP63-mitochondrial ribosomal protein 63 Gene
Size: 2ug
Accessions: BC000002
Gene id: 78988
Gene description: mitochondrial ribosomal protein 63
Synonyms: MRP63; bMRP63; ribosomal protein 63, mitochondrial; hMRP63; mitochondrial ribosomal protein 63; mitochondrial ribosomal protein bMRP63; mitochondrial ribosomal protein L57
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgttcctgactgcgctcctctggcgcggccgcattcccggccgtcagtggatcgggaagcaccggcggccgcggttcgtgtcgttgcgcgccaagcagaacatgatccgccgcctggagatcgaggcggagaaccattactggctgagcatgccctacatgacccgggagcaggagcgcggccacgccgcggtgcgcaggagggaggccttcgaggccataaaggcggccgccacttccaagttccccccgcatagattcattgcggaccagctcgaccatctcaatgtcaccaagaaatggtcctaa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice

30 other products in the same category: