Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
Data sheet of S100A11-S100 calcium binding protein A11 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about S100A11-S100 calcium binding protein A11 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC001410 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | S100A11 |
| Origin species: | Human |
| Product name: | S100A11-S100 calcium binding protein A11 Gene |
| Size: | 2ug |
| Accessions: | BC001410 |
| Gene id: | 6282 |
| Gene description: | S100 calcium binding protein A11 |
| Synonyms: | HEL-S-43; MLN70; S100C; protein S100-A11; MLN 70; calgizzarin; epididymis secretory protein Li 43; metastatic lymph node gene 70 protein; protein S100-C; S100 calcium binding protein A11 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggcaaaaatctccagccctacagagactgagcggtgcatcgagtccctgattgctgtcttccagaagtatgctggaaaggatggttataactacactctctccaagacagagttcctaagcttcatgaatacagaactagctgccttcacaaagaaccagaaggaccctggtgtccttgaccgcatgatgaagaaactggacaccaacagtgatggtcagctagatttctcagaatttcttaatctgattggtggcctagctatggcttgccatgactccttcctcaaggctgtcccttcccagaagcggacctga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - chromosome 8 open reading frame 4 - chemokine (C-X-C motif) ligand 13 - mitochondrial ribosomal protein S6 - chromosome 1 open reading frame 2 |