Login to display prices
Login to display prices
S100A11-S100 calcium binding protein A11 Gene View larger

S100A11-S100 calcium binding protein A11 Gene

PTXBC001410

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of S100A11-S100 calcium binding protein A11 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about S100A11-S100 calcium binding protein A11 Gene

Proteogenix catalog: PTXBC001410
Ncbi symbol: S100A11
Product name: S100A11-S100 calcium binding protein A11 Gene
Size: 2ug
Accessions: BC001410
Gene id: 6282
Gene description: S100 calcium binding protein A11
Synonyms: HEL-S-43; MLN70; S100C; protein S100-A11; MLN 70; calgizzarin; epididymis secretory protein Li 43; metastatic lymph node gene 70 protein; protein S100-C; S100 calcium binding protein A11
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggcaaaaatctccagccctacagagactgagcggtgcatcgagtccctgattgctgtcttccagaagtatgctggaaaggatggttataactacactctctccaagacagagttcctaagcttcatgaatacagaactagctgccttcacaaagaaccagaaggaccctggtgtccttgaccgcatgatgaagaaactggacaccaacagtgatggtcagctagatttctcagaatttcttaatctgattggtggcctagctatggcttgccatgactccttcctcaaggctgtcccttcccagaagcggacctga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice

30 other products in the same category: