Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
SUMO4-SMT3 suppressor of mif two 3 homolog 4 (S. cerevisiae) Gene
PTXBC130305
New product
Data sheet of SUMO4-SMT3 suppressor of mif two 3 homolog 4 (S. cerevisiae) Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about SUMO4-SMT3 suppressor of mif two 3 homolog 4 (S. cerevisiae) Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC130305 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | SUMO4 |
| Origin species: | Human |
| Product name: | SUMO4-SMT3 suppressor of mif two 3 homolog 4 (S. cerevisiae) Gene |
| Size: | 2ug |
| Accessions: | BC130305 |
| Gene id: | 387082 |
| Gene description: | SMT3 suppressor of mif two 3 homolog 4 (S. cerevisiae) |
| Synonyms: | IDDM5; SMT3H4; SUMO-4; dJ281H8.4; small ubiquitin-related modifier 4; SMT3 suppressor of mif two 3 homolog 2; SMT3 suppressor of mif two 3 homolog 4; insulin-dependent diabetes mellitus 5; small ubiquitin-like modifier 4 protein; small ubiquitin-like modifier 4 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggccaacgaaaagcccacagaagaagtcaagactgagaacaacaatcatattaatttgaaggtggcgggacaggatggttctgtggtgcagtttaagattaagaggcagacaccacttagtaaactaatgaaagcctattgtgaaccacggggattgtcagtgaagcagatcagattccgatttggtgggcaaccaatcagtggaacagacaaacctgcacagttggaaatggaagatgaagatacaattgatgtgtttcaacagcctacgggaggtgtctactga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - RNA binding motif, single stranded interacting protein - hypothetical protein BC008131 - interleukin 1 receptor antagonist - TIMP metallopeptidase inhibitor 3 |