No products
Prices are tax excluded
PTXBC130305
New product
This product is no longer in stock
Availability date:
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC130305 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | SUMO4 |
| Origin species: | Human |
| Product name: | SUMO4-SMT3 suppressor of mif two 3 homolog 4 (S. cerevisiae) Gene |
| Size: | 2ug |
| Accessions: | BC130305 |
| Gene id: | 387082 |
| Gene description: | SMT3 suppressor of mif two 3 homolog 4 (S. cerevisiae) |
| Synonyms: | IDDM5; SMT3H4; SUMO-4; dJ281H8.4; small ubiquitin-related modifier 4; SMT3 suppressor of mif two 3 homolog 2; SMT3 suppressor of mif two 3 homolog 4; insulin-dependent diabetes mellitus 5; small ubiquitin-like modifier 4 protein; small ubiquitin-like modifier 4 |
| Sequence primers: | Forward primer M13R (5'â3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'â3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggccaacgaaaagcccacagaagaagtcaagactgagaacaacaatcatattaatttgaaggtggcgggacaggatggttctgtggtgcagtttaagattaagaggcagacaccacttagtaaactaatgaaagcctattgtgaaccacggggattgtcagtgaagcagatcagattccgatttggtgggcaaccaatcagtggaacagacaaacctgcacagttggaaatggaagatgaagatacaattgatgtgtttcaacagcctacgggaggtgtctactga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20â |
| Delivery condition: | Blue Ice |
| Related products: | - RNA binding motif, single stranded interacting protein - hypothetical protein BC008131 - interleukin 1 receptor antagonist - TIMP metallopeptidase inhibitor 3 |