Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
Data sheet of CCL4L2-chemokine (C-C motif) ligand 4-like 2 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about CCL4L2-chemokine (C-C motif) ligand 4-like 2 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC130456 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | CCL4L2 |
| Origin species: | Human |
| Product name: | CCL4L2-chemokine (C-C motif) ligand 4-like 2 Gene |
| Size: | 2ug |
| Accessions: | BC130456 |
| Gene id: | 388372 |
| Gene description: | chemokine (C-C motif) ligand 4-like 2 |
| Synonyms: | AT744.2; CCL4L; SCYA4L; SCYQ4L2; C-C motif chemokine 4-like; MIP-1-beta; chemokine (C-C motif) ligand 4-like 2; macrophage inflammatory protein 1-beta; macrophage inflammatory protein-1b2; monocyte adherence-induced protein 5-alpha; small inducible cytokine A4-like; C-C motif chemokine ligand 4 like 2 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgaagctctgcgtgactgtcctgtctctcctcgtgctagtagctgccttctgctctctagcactctcagcaccaatgggctcagaccctcccaccgcctgctgcttttcttacaccgcgaggaagcttcctcgcaactttgtggtagattactatgagaccagcagcctctgctcccagccagctgtggtattccaaaccaaaagaggcaagcaagtctgcgctgaccccagtgagtcctgggtccaggagtacgtgtatgacctggaactgaactga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - chromosome 21 open reading frame 96 - chromosome 17 open reading frame 87 - interleukin 28A (interferon, lambda 2) - chromosome 9 open reading frame 106 |