Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
Data sheet of IL28A-interleukin 28A (interferon, lambda 2) Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about IL28A-interleukin 28A (interferon, lambda 2) Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC113581 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | IL28A |
| Origin species: | Human |
| Product name: | IL28A-interleukin 28A (interferon, lambda 2) Gene |
| Size: | 2ug |
| Accessions: | BC113581 |
| Gene id: | 282616 |
| Gene description: | interleukin 28A (interferon, lambda 2) |
| Synonyms: | IL28A; IL-28A; interferon lambda-2; IFN-lambda-2; cytokine Zcyto20; interleukin 28A (interferon, lambda 2); interleukin-28A; interferon lambda 2 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgaaactagacatgactggggactgcacgccagtgctggtgctgatggccgcagtgctgaccgtgactggagcagttcctgtcgccaggctccacggggctctcccggatgcaaggggctgccacatagcccagttcaagtccctgtctccacaggagctgcaggcctttaagagggccaaagatgccttagaagagtcgcttctgctgaaggactgcaggtgccactcccgcctcttccccaggacctgggacctgaggcagctgcaggtgagggagcgccccatggctttggaggctgagctggccctgacgctgaaggttctggaggccaccgctgacactgacccagccctggtggacgtcttggaccagccccttcacaccctgcaccatatcctctcccagttccgggcctgtatccagcctcagcccacggcagggcccaggacccggggccgcctccaccattggctgtaccggctccaggaggccccaaaaaaggagtcccctggctgcctcgaggcctctgtcaccttcaacctcttccgcctcctcacgcgagacctgaattgtgttgccagtggggacctgtgtgtctga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - chromosome 9 open reading frame 106 - solute carrier family 25, member 30 - chromosome 9 open reading frame 163 - chromosome 16 open reading frame 72 |