FDX1L-ferredoxin 1-like Gene View larger

FDX1L-ferredoxin 1-like Gene


New product

113,40 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of FDX1L-ferredoxin 1-like Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about FDX1L-ferredoxin 1-like Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC010155
Product type: DNA & cDNA
Ncbi symbol: FDX1L
Origin species: Human
Product name: FDX1L-ferredoxin 1-like Gene
Size: 2ug
Accessions: BC010155
Gene id: 112812
Gene description: ferredoxin 1-like
Synonyms: FDX2; ferredoxin-2, mitochondrial; adrenodoxin-like protein; adrenodoxin-like protein, mitochondrial; ferredoxin 1 like
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgctagacatggcccccctcctccaggagaactcgcggctgggctgccagattgtgctgacaccggagctggaaggagcggaattcaccctgcccaagatcaccaggaacttctacgtggatggccatgtccccaagccccactga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - metallothionein 2A
- metallothionein 1H
- acylglycerol kinase
- nuclear protein 1

Buy FDX1L-ferredoxin 1-like Gene now

Add to cart