MT1H-metallothionein 1H Gene View larger

MT1H-metallothionein 1H Gene


New product

113,40 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of MT1H-metallothionein 1H Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about MT1H-metallothionein 1H Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC008408
Product type: DNA & cDNA
Ncbi symbol: MT1H
Origin species: Human
Product name: MT1H-metallothionein 1H Gene
Size: 2ug
Accessions: BC008408
Gene id: 4496
Gene description: metallothionein 1H
Synonyms: MT-0; MT-1H; MT-IH; MT1; metallothionein-1H; metallothionein-0; metallothionein-IH; testicular tissue protein Li 123; metallothionein 1H
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggaccccaactgctcctgcgaggctggtggctcctgcgcctgcgccggctcctgcaagtgcaagaagtgcaaatgcacctcctgcaagaagagctgctgctcctgttgccccctgggctgtgccaagtgtgcccagggctgcatctgcaaaggggcgtcagagaagtgcagctgctgtgcctga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - acylglycerol kinase
- nuclear protein 1
- cofilin 2 (muscle)
- cytochrome b-561

Buy MT1H-metallothionein 1H Gene now

Add to cart