CYB561-cytochrome b-561 Gene View larger

CYB561-cytochrome b-561 Gene


New product

113,40 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of CYB561-cytochrome b-561 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about CYB561-cytochrome b-561 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC000021
Product type: DNA & cDNA
Ncbi symbol: CYB561
Origin species: Human
Product name: CYB561-cytochrome b-561 Gene
Size: 2ug
Accessions: BC000021
Gene id: 1534
Gene description: cytochrome b-561
Synonyms: CYB561A1; FRRS2; cytochrome b561; cytochrome b-561; cytochrome b561 family, member A1; ferric-chelate reductase 2
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggagggcggggccgcggcagccacccccacagcactgccttactacgtggccttctcccagctgctgggcctgaccttggtggccatgaccggcgcgtggctcgggctgtaccgaggcggcattgcctgggagagcgacctgcagttcaacgcgcaccccctctgcatggtcataggcctgatcttcctgcagggaaatgccctgctggtttaccgtgtcttcaggaacgaagctaaacgcaccaccaaggtcctgcacgggctgctgcacatctttgcgctcgtcatcgccctggttggcttggtggcggtgttcgactaccacaggaagaagggctacgctgacctgtacagcctacacagctggtgcgggatccttgtctttgtcctgtactttgtgcagtggctggtgggcttcagcttcttcctgttccccggagcttcattctccctgcggagccgctaccgcccacagcacatcttctttggtgctaccatcttcctcctttccgtgggcaccgccctgctgggcctgaaggaggcactgctgttcaacctcgggggcaagtatagcgcatttgagcccgagggtgtcctggccaacgtgctgggcctgctgctggcctgcttcggtggggcggtgctctacatcttgacccgggccgactggaagcggccttcccaggcggaagagcaggccctctccatggacttcaagacgctgacggagggagatagccccggctcccagtga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - spermidine synthase
- WD repeat domain 1
- nucleoporin 85kDa
- complement factor B

Buy CYB561-cytochrome b-561 Gene now

Add to cart