NUPR1-nuclear protein 1 Gene View larger

NUPR1-nuclear protein 1 Gene


New product

113,40 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of NUPR1-nuclear protein 1 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about NUPR1-nuclear protein 1 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC002434
Product type: DNA & cDNA
Ncbi symbol: NUPR1
Origin species: Human
Product name: NUPR1-nuclear protein 1 Gene
Size: 2ug
Accessions: BC002434
Gene id: 26471
Gene description: nuclear protein 1
Synonyms: COM1; nuclear protein 1; candidate of metastasis 1; nuclear protein, transcriptional regulator, 1; nuclear transcriptional regulator protein 1; protein p8; nuclear protein 1, transcriptional regulator
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggccaccttcccaccagcaaccagcgccccccagcagcccccaggcccggaggacgaggactccagcctggatgaatctgacctctatagcctggcccattcctacctcggaggtggaggccggaaaggtcgcaccaagagagaagctgctgccaacaccaaccgccccagccctggcgggcacgagaggaaactggtgaccaagctgcagaattcagagaggaagaagcgaggggcacggcgctga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - cofilin 2 (muscle)
- cytochrome b-561
- spermidine synthase
- WD repeat domain 1

Buy NUPR1-nuclear protein 1 Gene now

Add to cart