Login to display prices
Login to display prices
NUPR1-nuclear protein 1 Gene View larger

NUPR1-nuclear protein 1 Gene

PTXBC002434

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of NUPR1-nuclear protein 1 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about NUPR1-nuclear protein 1 Gene

Proteogenix catalog: PTXBC002434
Ncbi symbol: NUPR1
Product name: NUPR1-nuclear protein 1 Gene
Size: 2ug
Accessions: BC002434
Gene id: 26471
Gene description: nuclear protein 1
Synonyms: COM1; nuclear protein 1; candidate of metastasis 1; nuclear protein, transcriptional regulator, 1; nuclear transcriptional regulator protein 1; protein p8; nuclear protein 1, transcriptional regulator
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggccaccttcccaccagcaaccagcgccccccagcagcccccaggcccggaggacgaggactccagcctggatgaatctgacctctatagcctggcccattcctacctcggaggtggaggccggaaaggtcgcaccaagagagaagctgctgccaacaccaaccgccccagccctggcgggcacgagaggaaactggtgaccaagctgcagaattcagagaggaagaagcgaggggcacggcgctga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice

30 other products in the same category: