MT2A-metallothionein 2A Gene View larger

MT2A-metallothionein 2A Gene


New product

113,40 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of MT2A-metallothionein 2A Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about MT2A-metallothionein 2A Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC007034
Product type: DNA & cDNA
Ncbi symbol: MT2A
Origin species: Human
Product name: MT2A-metallothionein 2A Gene
Size: 2ug
Accessions: BC007034
Gene id: 4502
Gene description: metallothionein 2A
Synonyms: MT2; metallothionein-2; MT-2; MT-II; metallothionein-II; metallothionein 2A
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggatcccaactgctcctgcgccgccggtgactcctgcacctgcgccggctcctgcaaatgcaaagagtgcaaatgcacctcctgcaagaaaagctgctgctcctgctgccctgtgggctgtgccaagtgtgcccagggctgcatctgcaaaggggcgtcggacaagtgcagctgctgcgcctga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - metallothionein 1H
- acylglycerol kinase
- nuclear protein 1
- cofilin 2 (muscle)

Buy MT2A-metallothionein 2A Gene now

Add to cart