UBB-ubiquitin B Gene View larger

UBB-ubiquitin B Gene

PTXBC000379

New product

113,40 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of UBB-ubiquitin B Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about UBB-ubiquitin B Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC000379
Product type: DNA & cDNA
Ncbi symbol: UBB
Origin species: Human
Product name: UBB-ubiquitin B Gene
Size: 2ug
Accessions: BC000379
Gene id: 7314
Gene description: ubiquitin B
Synonyms: HEL-S-50; polyubiquitin-B; epididymis secretory protein Li 50; polyubiquitin B; ubiquitin B
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgcagatcttcgtgaaaacccttaccggcaagaccatcacccttgaggtggagcccagtgacaccatcgaaaatgtgaaggccaagatccaggataaggaaggcattccccccgaccagcagaggctcatctttgcaggcaagcagctggaagacggccgtactctttctgactacaacatccagaaggagtcgaccctgcacctggtcctgcgtctgagaggtggtatgcagatcttcgtgaagaccctgaccggcaagaccatcaccctggaagtggagcccagtgacaccatcgaaaatgtgaaggccaagatccaggataaagaaggcatccctcccgaccagcagaggctcatctttgcaggcaagcagctggaagatggccgcactctttctgactacaacatccagaaggagtcgaccctgcacctggtcctgcgtctgagaggtggtatgcagatcttcgtgaagaccctgaccggcaagaccatcactctggaggtggagcccagtgacaccatcgaaaatgtgaaggccaagatccaagataaagaaggcatcccccccgaccagcagaggctcatctttgcaggcaagcagctggaagatggccgcactctttctgactacaacatccagaaagagtcgaccctgcacctggtcctgcgcctgaggggtggctgttaa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - surfeit 2
- cullin 4B
- smoothelin
- ring-box 1

Buy UBB-ubiquitin B Gene now

Add to cart