RBX1-ring-box 1 Gene View larger

RBX1-ring-box 1 Gene


New product

113,40 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of RBX1-ring-box 1 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about RBX1-ring-box 1 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC001466
Product type: DNA & cDNA
Ncbi symbol: RBX1
Origin species: Human
Product name: RBX1-ring-box 1 Gene
Size: 2ug
Accessions: BC001466
Gene id: 9978
Gene description: ring-box 1
Synonyms: E3 ubiquitin-protein ligase RBX1; BA554C12.1; RNF75; ROC1; RING finger protein 75; RING-box protein 1; ZYP protein; regulator of cullins 1; ring-box 1, E3 ubiquitin protein ligase; ring-box 1
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggcggcagcgatggatgtggataccccgagcggcaccaacagcggcgcgggcaagaagcgctttgaagtgaaaaagtggaatgcagtagccctctgggcctgggatattgtggttgataactgtgccatctgcaggaaccacattatggatctttgcatagaatgtcaagctaaccaggcgtccgctacttcagaagagtgtactgtcgcatggggagtctgtaaccatgcttttcacttccactgcatctctcgctggctcaaaacacgacaggtgtgtccattggacaacagagagtgggaattccaaaagtatgggcactag
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - adipogenin
- profilin 1
- ubiquitin D
- GSG1-like

Buy RBX1-ring-box 1 Gene now

Add to cart