Login to display prices
Login to display prices
PFN1-profilin 1 Gene View larger

PFN1-profilin 1 Gene

PTXBC002475

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of PFN1-profilin 1 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about PFN1-profilin 1 Gene

Proteogenix catalog: PTXBC002475
Ncbi symbol: PFN1
Product name: PFN1-profilin 1 Gene
Size: 2ug
Accessions: BC002475
Gene id: 5216
Gene description: profilin 1
Synonyms: ALS18; profilin-1; epididymis tissue protein Li 184a; profilin I; profilin 1
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggccgggtggaacgcctacatcgacaacctcatggcggacgggacctgtcaggacgcggccatcgtgggctacaaggactcgccctccgtctgggccgccgtccccgggaaaacgttcgtcaacatcacgccagctgaggtgggtgtcctggttggcaaagaccggtcaagtttttacgtgaatgggctgacacttgggggccagaaatgttcggtgatccgggactcactgctgcaggatggggaatttagcatggatcttcgtaccaagagcaccggtggggcccccaccttcaatgtcactgtcaccaagactgacaagacgctagtcctgctgatgggcaaagaaggtgtccacggtggtttgatcaacaagaaatgttatgaaatggcctcccaccttcggcgttcccagtactga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice