UBD-ubiquitin D Gene View larger

UBD-ubiquitin D Gene

PTXBC012472

New product

113,40 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of UBD-ubiquitin D Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about UBD-ubiquitin D Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC012472
Product type: DNA & cDNA
Ncbi symbol: UBD
Origin species: Human
Product name: UBD-ubiquitin D Gene
Size: 2ug
Accessions: BC012472
Gene id: 10537
Gene description: ubiquitin D
Synonyms: UBD-3; FAT10; GABBR1; ubiquitin D; diubiquitin; ubiquitin-like protein FAT10
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggctcccaatgcttcctgcctctgtgtgcatgtccgttccgaggaatgggatttaatgacctttgatgccaacccatatgacagcgtgaaaaaaatcaaagaacatgtccggtctaagaccaaggttcctgtgcaggaccaggttcttttgctgggctccaagatcttaaagccacggagaagcctctcatcttatggcattgacaaagagaagaccatccaccttaccctgaaagtggtgaagcccagtgatgaggagctgcccttgtttcttgtggagtcaggtgatgaggcaaagaggcacctcctccaggtgcgaaggtccagctcagtggcacaagtgaaagcaatgatcgagactaagacgggtataatccctgagacccagattgtgacttgcaatggaaagagactggaagatgggaagatgatggcagattacggcatcagaaagggcaacttactcttcctggcatgttattgcattggagggtga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - GSG1-like
- cytoglobin
- recoverin
- ephrin-A1

Buy UBD-ubiquitin D Gene now

Add to cart