EFNA1-ephrin-A1 Gene View larger

EFNA1-ephrin-A1 Gene


New product

113,40 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of EFNA1-ephrin-A1 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about EFNA1-ephrin-A1 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC032698
Product type: DNA & cDNA
Ncbi symbol: EFNA1
Origin species: Human
Product name: EFNA1-ephrin-A1 Gene
Size: 2ug
Accessions: BC032698
Gene id: 1942
Gene description: ephrin-A1
Synonyms: B61; ECKLG; EFL1; EPLG1; LERK-1; LERK1; TNFAIP4; ephrin-A1; TNF alpha-induced protein 4; eph-related receptor tyrosine kinase ligand 1; immediate early response protein B61; ligand of eph-related kinase 1; tumor necrosis factor, alpha-induced protein 4; ephrin A1
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggagttcctctgggcccctctcttgggtctgtgctgcagtctggccgctgctgatcgccacaccgtcttctggaacagttcaaatcccaagttccggaatgaggactacaccatacatgtgcagctgaatgactacgtggacatcatctgtccgcactatgaagatcactctgtggcagacgctgccatggagcagtacatactgtacctggtggagcatgaggagtaccagctgtgccagccccagtccaaggaccaagtccgctggcagtgcaaccggcccagtgccaagcatggcccggagaagctgtctgagaagttccagcgcttcacacctttcaccctgggcaaggagttcaaagaaggacacagctactactacatctccaaacccatccaccagcatgaagaccgctgcttgaggttgaaggtgactgtcagtggcaaaatcactcacagtcctcaggcccatgtcaatccacaggagaagagacttgcagcagatgacccagaggtgcgggttctacatagcatcgctcacagtgctgccccacgcctcttcccacttgcctggactgtgctgctccttccacttctgctgctgcaaaccccgtga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - claudin 4
- claudin 7
- claudin 2
- sestrin 3

Buy EFNA1-ephrin-A1 Gene now

Add to cart