Cart 16 Product Products 2 343,40 € (empty)
-
1 x HS2ST1-hep...113,40 € -
1 x TDGF1-tera...113,40 € -
-
1 x HJURP-Holl...121,50 € -
1 x DKFZp566H0...113,40 € -
-
1 x PSG6-pregn...121,50 € -
1 x Anti-Trans...384,12 € -
1 x GCK-glucok...121,50 € -
1 x COX7C-cyto...113,40 € -
1 x NUDT4-nudi...113,40 € -
1 x AGXT2L2-al...121,50 € -
1 x ARGLU1-arg...121,50 € -
1 x NUDT16-nud...113,40 € -
1 x TRAM2-tran...121,50 € -
1 x FAM92A1-fa...121,50 €
No products
To be determined Shipping
2 343,40 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 16 items in your cart. There is 1 item in your cart.
Total products (tax excl.) 2 343,40 €
Total shipping (tax excl.) To be determined
Total (tax excl.) 2 343,40 €
Data sheet of EFNA1-ephrin-A1 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about EFNA1-ephrin-A1 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC032698 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | EFNA1 |
| Origin species: | Human |
| Product name: | EFNA1-ephrin-A1 Gene |
| Size: | 2ug |
| Accessions: | BC032698 |
| Gene id: | 1942 |
| Gene description: | ephrin-A1 |
| Synonyms: | B61; ECKLG; EFL1; EPLG1; LERK-1; LERK1; TNFAIP4; ephrin-A1; TNF alpha-induced protein 4; eph-related receptor tyrosine kinase ligand 1; immediate early response protein B61; ligand of eph-related kinase 1; tumor necrosis factor, alpha-induced protein 4; ephrin A1 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggagttcctctgggcccctctcttgggtctgtgctgcagtctggccgctgctgatcgccacaccgtcttctggaacagttcaaatcccaagttccggaatgaggactacaccatacatgtgcagctgaatgactacgtggacatcatctgtccgcactatgaagatcactctgtggcagacgctgccatggagcagtacatactgtacctggtggagcatgaggagtaccagctgtgccagccccagtccaaggaccaagtccgctggcagtgcaaccggcccagtgccaagcatggcccggagaagctgtctgagaagttccagcgcttcacacctttcaccctgggcaaggagttcaaagaaggacacagctactactacatctccaaacccatccaccagcatgaagaccgctgcttgaggttgaaggtgactgtcagtggcaaaatcactcacagtcctcaggcccatgtcaatccacaggagaagagacttgcagcagatgacccagaggtgcgggttctacatagcatcgctcacagtgctgccccacgcctcttcccacttgcctggactgtgctgctccttccacttctgctgctgcaaaccccgtga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - claudin 4 - claudin 7 - claudin 2 - sestrin 3 |