CLDN2-claudin 2 Gene View larger

CLDN2-claudin 2 Gene

PTXBC014424

New product

113,40 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of CLDN2-claudin 2 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about CLDN2-claudin 2 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC014424
Product type: DNA & cDNA
Ncbi symbol: CLDN2
Origin species: Human
Product name: CLDN2-claudin 2 Gene
Size: 2ug
Accessions: BC014424
Gene id: 9075
Gene description: claudin 2
Synonyms: claudin-2; SP82; claudin 2
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggcctctcttggcctccaacttgtgggctacatcctaggccttctggggcttttgggcacactggttgccatgctgctccccagctggaaaacaagttcttatgtcggtgccagcattgtgacagcagttggcttctccaagggcctctggatggaatgtgccacacacagcacaggcatcacccagtgtgacatctatagcacccttctgggcctgcccgctgacatccaggctgcccaggccatgatggtgacatccagtgcaatctcctccctggcctgcattatctctgtggtgggcatgagatgcacagtcttctgccaggaatcccgagccaaagacagagtggcggtagcaggtggagtctttttcatccttggaggcctcctgggattcattcctgttgcctggaatcttcatgggatcctacgggacttctactcaccactggtgcctgacagcatgaaatttgagattggagaggctctttacttgggcattatttcttccctgttctccctgatagctggaatcatcctctgcttttcctgctcatcccagagaaatcgctccaactactacgatgcctaccaagcccaacctcttgccacaaggagctctccaaggcctggtcaacctcccaaagtcaagagtgagttcaattcctacagcctgacagggtatgtgtga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - sestrin 3
- folliculin
- ephrin-B1
- pleckstrin

Buy CLDN2-claudin 2 Gene now

Add to cart