Login to display prices
Login to display prices
CLDN2-claudin 2 Gene View larger

CLDN2-claudin 2 Gene

PTXBC014424

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of CLDN2-claudin 2 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about CLDN2-claudin 2 Gene

Proteogenix catalog: PTXBC014424
Ncbi symbol: CLDN2
Product name: CLDN2-claudin 2 Gene
Size: 2ug
Accessions: BC014424
Gene id: 9075
Gene description: claudin 2
Synonyms: claudin-2; SP82; claudin 2
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggcctctcttggcctccaacttgtgggctacatcctaggccttctggggcttttgggcacactggttgccatgctgctccccagctggaaaacaagttcttatgtcggtgccagcattgtgacagcagttggcttctccaagggcctctggatggaatgtgccacacacagcacaggcatcacccagtgtgacatctatagcacccttctgggcctgcccgctgacatccaggctgcccaggccatgatggtgacatccagtgcaatctcctccctggcctgcattatctctgtggtgggcatgagatgcacagtcttctgccaggaatcccgagccaaagacagagtggcggtagcaggtggagtctttttcatccttggaggcctcctgggattcattcctgttgcctggaatcttcatgggatcctacgggacttctactcaccactggtgcctgacagcatgaaatttgagattggagaggctctttacttgggcattatttcttccctgttctccctgatagctggaatcatcctctgcttttcctgctcatcccagagaaatcgctccaactactacgatgcctaccaagcccaacctcttgccacaaggagctctccaaggcctggtcaacctcccaaagtcaagagtgagttcaattcctacagcctgacagggtatgtgtga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice

30 other products in the same category: