Login to display prices
Login to display prices
RCVRN-recoverin Gene View larger

RCVRN-recoverin Gene

PTXBC001720

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of RCVRN-recoverin Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about RCVRN-recoverin Gene

Proteogenix catalog: PTXBC001720
Ncbi symbol: RCVRN
Product name: RCVRN-recoverin Gene
Size: 2ug
Accessions: BC001720
Gene id: 5957
Gene description: recoverin
Synonyms: RCV1; cancer associated retinopathy antigen; cancer-associated retinopathy protein
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggggaacagcaaaagtggggccctgtccaaggagatcctggaggagctgcagctgaacaccaagttctcggaggaggagctgtgctcctggtaccagtccttcctgaaggactgtcccaccggccgcatcacccagcagcagttccagagcatctacgccaagttcttccccgacaccgaccccaaggcctacgcccagcatgtgttccgcagcttcgattccaacctcgacggcaccctggacttcaaggagtacgtcatcgccctgcacatgaccaccgcgggcaagaccaaccagaagctggagtgggccttctccctctacgacgtggacggtaacgggaccatcagcaagaatgaagtgctggagatcgtcatggctattttcaaaatgatcactcccgaggacgtgaagctccttccagacgatgaaaacacgccggaaaagcgagccgagaagatctggaagtactttggaaagaatgatgatgataaacttacagagaaagaattcattgaggggacactggccaataaggaaattctgcgactgatccagtttgagcctcaaaaagtgaaggaaaagatgaagaacgcctga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice

30 other products in the same category: