Cart 11 Product Products 2 694,60 € (empty)
-
1 x HIATL1-hip...121,50 € -
-
1 x PIP4K2A-ph...121,50 € -
1 x FAM177A1-f...113,40 € -
1 x DUSP6-dual...121,50 € -
1 x S100B-S100...113,40 € -
1 x NCOA7-nucl...113,40 € -
-
-
1 x FAM176A-fa...113,40 € -
1 x PIK3R5-pho...121,50 €
No products
To be determined Shipping
2 694,60 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 11 items in your cart. There is 1 item in your cart.
Total products (tax excl.) 2 694,60 €
Total shipping (tax excl.) To be determined
Total (tax excl.) 2 694,60 €
Data sheet of CYGB-cytoglobin Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about CYGB-cytoglobin Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC029798 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | CYGB |
| Origin species: | Human |
| Product name: | CYGB-cytoglobin Gene |
| Size: | 2ug |
| Accessions: | BC029798 |
| Gene id: | 114757 |
| Gene description: | cytoglobin |
| Synonyms: | HGB; STAP; histoglobin; stellate cell activation-associated protein |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggagaaagtgccaggcgagatggagatcgagcgcagggagcggagcgaggagctgtccgaggcggagaggaaggcggtgcaggctatgtgggcccggctctatgccagctgcgaggacgtgggggtggccatcctggtgaggttctttgtgaacttcccctcggccaagcagtacttcagccagttcaagcacatggaggatcccctggagatggagcggagcccccagctgcggaagcacgcctgccgagtcatgggggccctcaacactgtcgtggagaacctgcatgaccccgacaaggtgtcctctgtgctcgcccttgtggggaaagcccacgccctcaagcacaaggtggaaccggtgtacttcaagatcctctctggggtcattctggaggtggtcgccgaggaatttgccagtgacttcccacctgagacgcagagagcctgggccaagctgcgtggcctcatctacagccacgtgaccgctgcctacaaggaagtgggctgggtgcagcaggtccccaacgccaccaccccaccggccacactgccctcttcggggccgtag |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - recoverin - ephrin-A1 - claudin 4 - claudin 7 |