Login to display prices
Login to display prices
CYGB-cytoglobin Gene View larger

CYGB-cytoglobin Gene

PTXBC029798

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of CYGB-cytoglobin Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about CYGB-cytoglobin Gene

Proteogenix catalog: PTXBC029798
Ncbi symbol: CYGB
Product name: CYGB-cytoglobin Gene
Size: 2ug
Accessions: BC029798
Gene id: 114757
Gene description: cytoglobin
Synonyms: HGB; STAP; histoglobin; stellate cell activation-associated protein
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggagaaagtgccaggcgagatggagatcgagcgcagggagcggagcgaggagctgtccgaggcggagaggaaggcggtgcaggctatgtgggcccggctctatgccagctgcgaggacgtgggggtggccatcctggtgaggttctttgtgaacttcccctcggccaagcagtacttcagccagttcaagcacatggaggatcccctggagatggagcggagcccccagctgcggaagcacgcctgccgagtcatgggggccctcaacactgtcgtggagaacctgcatgaccccgacaaggtgtcctctgtgctcgcccttgtggggaaagcccacgccctcaagcacaaggtggaaccggtgtacttcaagatcctctctggggtcattctggaggtggtcgccgaggaatttgccagtgacttcccacctgagacgcagagagcctgggccaagctgcgtggcctcatctacagccacgtgaccgctgcctacaaggaagtgggctgggtgcagcaggtccccaacgccaccaccccaccggccacactgccctcttcggggccgtag
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice

30 other products in the same category: