Login to display prices
Login to display prices
ADIG-adipogenin Gene View larger

ADIG-adipogenin Gene

PTXBC029594

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of ADIG-adipogenin Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about ADIG-adipogenin Gene

Proteogenix catalog: PTXBC029594
Ncbi symbol: ADIG
Product name: ADIG-adipogenin Gene
Size: 2ug
Accessions: BC029594
Gene id: 149685
Gene description: adipogenin
Synonyms: SMAF1; adipogenin; adipogenesis associated; small adipocyte factor 1 (SMAF1)
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgactccagtgtgtgcttggattgggagccctggagcaaaggcccagctgagttttgctggaaggggacactccacggccaagagaaggagaggccctgctggtgagcctgctgtgccaggtgaggcacttccaggggccagggggagcctcaaggcccacccaaagccttgggcagctgctatgtgggcaagaggctgcctccaccatattagagtttggttttcctggagtcagcagggcagtggcaatggcagaagtggatgggagagacttgccagggaggcaagaggactttggcaactgtggtgcctccctggaacccccaactcatctcctcttcagaccgacatgtga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice

30 other products in the same category: