Login to display prices
Login to display prices
DDA1-DET1 and DDB1 associated 1 Gene View larger

DDA1-DET1 and DDB1 associated 1 Gene


New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of DDA1-DET1 and DDB1 associated 1 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about DDA1-DET1 and DDB1 associated 1 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC000615
Product type: DNA & cDNA
Ncbi symbol: DDA1
Origin species: Human
Product name: DDA1-DET1 and DDB1 associated 1 Gene
Size: 2ug
Accessions: BC000615
Gene id: 79016
Gene description: DET1 and DDB1 associated 1
Synonyms: C19orf58; PCIA1; DET1- and DDB1-associated protein 1; PCIA-1; cross-immune reaction antigen PCIA1; placenta cross-immune reaction antigen 1; DET1 and DDB1 associated 1
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggcagattttttgaaaggactgcctgtctacaacaaaagcaattttagtcgatttcacgcggactccgtgtgcaaagcctcgaaccgacggccctcagtctacctgcctacccgcgagtacccgtctgaacagatcatcgtgacagaaaagacaaacatcctcctgcgctacctgcatcagcaatgggacaaaaagaacgctgccaagaagagagaccaggagcaagtggagctggaaggcgagagctccgcacctccccgcaaggtggcgcggaccgacagcccagacatgcacgaggacacttaa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - transmembrane protein 93
- PDZ domain containing 11
- stathmin 1/oncoprotein 18
- transmembrane protein 85