TMEM93-transmembrane protein 93 Gene View larger

TMEM93-transmembrane protein 93 Gene


New product

113,40 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of TMEM93-transmembrane protein 93 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about TMEM93-transmembrane protein 93 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC001409
Product type: DNA & cDNA
Ncbi symbol: TMEM93
Origin species: Human
Product name: TMEM93-transmembrane protein 93 Gene
Size: 2ug
Accessions: BC001409
Gene id: 83460
Gene description: transmembrane protein 93
Synonyms: TMEM93; ER membrane protein complex subunit 6; transmembrane protein 93
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggccgcggtggtggccaagcgggaagggccgccgttcatcagcgaggcggccgtgcggggcaacgccgccgtcctggattattgccggacctcggtgtcagcgctgtcgggggccacggccggcatcctcggcctcaccggcctctacggcttcatcttctacctgctcgcctccgtcctgctctccctgctcctcattctcaaggcgggaaggaggtggaacaaatatttcaaatcacggagacctctctttacaggaggcctcatcgggggcctcttcacctacgtcctgttctggacgttcctctacggcatggtgcacgtctactga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - PDZ domain containing 11
- stathmin 1/oncoprotein 18
- transmembrane protein 85
- glycine-N-acyltransferase

Buy TMEM93-transmembrane protein 93 Gene now

Add to cart