Login to display prices
Login to display prices
CAV2-caveolin 2 Gene View larger

CAV2-caveolin 2 Gene


New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of CAV2-caveolin 2 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about CAV2-caveolin 2 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC005256
Product type: DNA & cDNA
Ncbi symbol: CAV2
Origin species: Human
Product name: CAV2-caveolin 2 Gene
Size: 2ug
Accessions: BC005256
Gene id: 858
Gene description: caveolin 2
Synonyms: CAV; caveolae protein, 20-kD; caveolin 2 isoform a and b; caveolin 2
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggggctggagacggagaaggcggacgtacagctcttcatggacgacgactcctacagccaccacagcggcctcgagtacgccgaccccgagaagttcgcggactcggaccaggaccgggatccccaccggctcaactcgcatctcaagctgggcttcgaggatgtgatcgcagagccggtgactacgcactcctttgacaaagtgtggatctgcagccatgccctctttgaaatcagcaaatacgtaatgtacaagttcctgacggtgttcctggccattcccctggccttcattgcgggaattctctttgccaccctcagctgtctgcacatctggattttaatgccttttgtaaagacctgcctaatggttctgccttcagtgcagacaatatggaagagtgtgacagatgttatcattgctccattgtgtacgagcgtaggacgatgcttctcttctgtcagcctgcaactgagccaggattga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - claudin 1
- syntaxin 6
- retbindin
- syntaxin 7