CLDN1-claudin 1 Gene View larger

CLDN1-claudin 1 Gene

PTXBC012471

New product

113,40 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of CLDN1-claudin 1 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about CLDN1-claudin 1 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC012471
Product type: DNA & cDNA
Ncbi symbol: CLDN1
Origin species: Human
Product name: CLDN1-claudin 1 Gene
Size: 2ug
Accessions: BC012471
Gene id: 9076
Gene description: claudin 1
Synonyms: CLD1; ILVASC; SEMP1; senescence-associated epithelial membrane protein 1; claudin 1
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggccaacgcggggctgcagctgttgggcttcattctcgccttcctgggatggatcggcgccatcgtcagcactgccctgccccagtggaggatttactcctatgccggcgacaacatcgtgaccgcccaggccatgtacgaggggctgtggatgtcctgcgtgtcgcagagcaccgggcagatccagtgcaaagtctttgactccttgctgaatctgagcagcacattgcaagcaacccgtgccttgatggtggttggcatcctcctgggagtgatagcaatctttgtggccaccgttggcatgaagtgtatgaagtgcttggaagacgatgaggtgcagaagatgaggatggctgtcattgggggcgcgatatttcttcttgcaggtctggctattttagttgccacagcatggtatggcaatagaatcgttcaagaattctatgaccctatgaccccagtcaatgccaggtacgaatttggtcaggctctcttcactggctgggctgctgcttctctctgccttctgggaggtgccctactttgctgttcctgtccccgaaaaacaacctcttacccaacaccaaggccctatccaaaacctgcaccttccagcgggaaagactacgtgtga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - syntaxin 6
- retbindin
- syntaxin 7
- syntaxin 5

Buy CLDN1-claudin 1 Gene now

Add to cart