STX7-syntaxin 7 Gene View larger

STX7-syntaxin 7 Gene

PTXBC011975

New product

113,40 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of STX7-syntaxin 7 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about STX7-syntaxin 7 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC011975
Product type: DNA & cDNA
Ncbi symbol: STX7
Origin species: Human
Product name: STX7-syntaxin 7 Gene
Size: 2ug
Accessions: BC011975
Gene id: 8417
Gene description: syntaxin 7
Synonyms: syntaxin-7; syntaxin 7
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgtcttacactccaggagttggtggtgaccccgcccagttggcccagaggatctcttctaacatccagaagatcacacagtgttctgtggaaatacaaagaactctgaatcaacttggaacacctcaagattcacctgaattgaggcaacagttgcaacagaagcagcagtatactaaccagcttgccaaagaaacagataagtacattaaagagtttggatctctgcccaccacccccagtgaacagcgtcaaaggaaaatacagaaggatcgcttagtggcagagttcacaacatcactgacaaacttccagaaggtccagaggcaggctgctgagcgagagaaagagtttgttgctcgagtaagagccagttccagagtgtctggcagttttcctgaggacagctcaaaagaaaggaatcttgtatcctgggaaagccaaactcaacctcaagtgcaggtgcaggatgaagaaattacagaggatgacctccgtcttattcatgagagagaatcttctatcaggcaacttgaagctgatattatggatattaatgaaatatttaaagatttgggaatgatgattcatgaacaaggagatgtaatagatagcatagaagccaatgtggaaaatgcagaggtgcacgttcagcaagcaaatcagcagctgtcaagggcagcagattatcagcgcaaatccagaaaaaccctgtgcatcatcattcttatccttgtcattggagttgcgattatcagtctcatcatatggggattgaaccactga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - syntaxin 5
- exportin 5
- syntaxin 3
- cyclin D3

Buy STX7-syntaxin 7 Gene now

Add to cart