STX6-syntaxin 6 Gene View larger

STX6-syntaxin 6 Gene

PTXBC009944

New product

113,40 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of STX6-syntaxin 6 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about STX6-syntaxin 6 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC009944
Product type: DNA & cDNA
Ncbi symbol: STX6
Origin species: Human
Product name: STX6-syntaxin 6 Gene
Size: 2ug
Accessions: BC009944
Gene id: 10228
Gene description: syntaxin 6
Synonyms: syntaxin-6
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgtccatggaggaccccttctttgtggtgaaaggagaggtacagaaagcagtcaacactgcccagggattgtttcagagatggacagagctcctccaggacccctccacagcaacaagggaagaaatcgactggaccaccaacgagctgagaaataacctccggagcatagagtgggatctagaggaccttgatgaaaccatcagcatagttgaagcaaatcctagaaaatttaaccttgatgcaactgaattgagtataagaaaagccttcattacaagtactcggcaagttgtcagggacatgaaagatcagatgtcaacttcatctgtgcaggcattagctgaaagaaaaaatagacaggcactgctgggagacagtggcagccagaactggagcactggaacaacagataaatatgggcgtctggaccgagagctccagagagccaattctcatttcattgaggagcagcaggcacagcagcagttgatcgtggaacagcaggatgagcagttggagctggtctctggcagcatcggggtgctgaagaacatgtcccagcgcatcggaggggagctggaggaacaggcagttatgttggaagatttctctcacgaattggagagcactcagtcccggctggacaatgtgatgaagaaacttgcaaaagtatctcatatgaccagtgatcggcgccaatggtgtgccatagccatcctctttgcagtcctgttggttgtgctcatcctcttcttagtgctgtga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - retbindin
- syntaxin 7
- syntaxin 5
- exportin 5

Buy STX6-syntaxin 6 Gene now

Add to cart