Login to display prices
Login to display prices
IL1RN-interleukin 1 receptor antagonist Gene View larger

IL1RN-interleukin 1 receptor antagonist Gene

PTXBC009745

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of IL1RN-interleukin 1 receptor antagonist Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about IL1RN-interleukin 1 receptor antagonist Gene

Proteogenix catalog: PTXBC009745
Ncbi symbol: IL1RN
Product name: IL1RN-interleukin 1 receptor antagonist Gene
Size: 2ug
Accessions: BC009745
Gene id: 3557
Gene description: interleukin 1 receptor antagonist
Synonyms: DIRA; ICIL-1RA; IL-1RN; IL-1ra; IL-1ra3; IL1F3; IL1RA; IRAP; MVCD4; interleukin-1 receptor antagonist protein; IL1 inhibitor; intracellular IL-1 receptor antagonist type II; intracellular interleukin-1 receptor antagonist (icIL-1ra); type II interleukin-1 receptor antagonist; interleukin 1 receptor antagonist
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggctttagagacgatctgccgaccctctgggagaaaatccagcaagatgcaagccttcagaatctgggatgttaaccagaagaccttctatctgaggaacaaccaactagttgccggatacttgcaaggaccaaatgtcaatttagaagaaaagatagatgtggtacccattgagcctcatgctctgttcttgggaatccatggagggaagatgtgcctgtcctgtgtcaagtctggtgatgagaccagactccagctggaggcagttaacatcactgacctgagcgagaacagaaagcaggacaagcgcttcgccttcatccgctcagacagtggccccaccaccagttttgagtctgccgcctgccccggttggttcctctgcacagcgatggaagctgaccagcccgtcagcctcaccaatatgcctgacgaaggcgtcatggtcaccaaattctacttccaggaggacgagtag
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice

30 other products in the same category: