Login to display prices
Login to display prices
RAB5A-RAB5A, member RAS oncogene family Gene View larger

RAB5A-RAB5A, member RAS oncogene family Gene

PTXBC001267

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of RAB5A-RAB5A, member RAS oncogene family Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about RAB5A-RAB5A, member RAS oncogene family Gene

Proteogenix catalog: PTXBC001267
Ncbi symbol: RAB5A
Product name: RAB5A-RAB5A, member RAS oncogene family Gene
Size: 2ug
Accessions: BC001267
Gene id: 5868
Gene description: RAB5A, member RAS oncogene family
Synonyms: RAB5A, member RAS oncogene family; RAS-associated protein RAB5A; ras-related protein Rab-5A
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggctagtcgaggcgcaacaagacccaacgggccaaatactggaaataaaatatgccagttcaaactagtacttctgggagagtccgctgttggcaaatcaagcctagtgcttcgttttgtgaaaggccaatttcatgaatttcaagagagtaccattggggctgcttttctaacccaaactgtatgtcttgatgacactacagtaaagtttgaaatatgggatacagctggtcaagaacgataccatagcctagcaccaatgtactacagaggagcacaagcagccatagttgtatatgatatcacaaatgaggagtcctttgcaagagcaaaaaattgggttaaagaacttcagaggcaagcaagtcctaacattgtaatagctttatcgggaaacaaggccgacctagcaaataaaagagcagtagatttccaggaagcacagtcctatgcagatgacaatagtttattattcatggagacatccgctaaaacatcaatgaatgtaaatgaaatattcatggcaatagctaaaaaattgccaaagaatgaaccacaaaatccaggagcaaattctgccagaggaagaggagtagaccttaccgaacccacacaaccaaccaggaatcagtgttgtagtaactaa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice

30 other products in the same category: