RAB5A-RAB5A, member RAS oncogene family Gene View larger

RAB5A-RAB5A, member RAS oncogene family Gene

PTXBC001267

New product

113,40 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of RAB5A-RAB5A, member RAS oncogene family Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about RAB5A-RAB5A, member RAS oncogene family Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC001267
Product type: DNA & cDNA
Ncbi symbol: RAB5A
Origin species: Human
Product name: RAB5A-RAB5A, member RAS oncogene family Gene
Size: 2ug
Accessions: BC001267
Gene id: 5868
Gene description: RAB5A, member RAS oncogene family
Synonyms: RAB5A, member RAS oncogene family; RAS-associated protein RAB5A; ras-related protein Rab-5A
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggctagtcgaggcgcaacaagacccaacgggccaaatactggaaataaaatatgccagttcaaactagtacttctgggagagtccgctgttggcaaatcaagcctagtgcttcgttttgtgaaaggccaatttcatgaatttcaagagagtaccattggggctgcttttctaacccaaactgtatgtcttgatgacactacagtaaagtttgaaatatgggatacagctggtcaagaacgataccatagcctagcaccaatgtactacagaggagcacaagcagccatagttgtatatgatatcacaaatgaggagtcctttgcaagagcaaaaaattgggttaaagaacttcagaggcaagcaagtcctaacattgtaatagctttatcgggaaacaaggccgacctagcaaataaaagagcagtagatttccaggaagcacagtcctatgcagatgacaatagtttattattcatggagacatccgctaaaacatcaatgaatgtaaatgaaatattcatggcaatagctaaaaaattgccaaagaatgaaccacaaaatccaggagcaaattctgccagaggaagaggagtagaccttaccgaacccacacaaccaaccaggaatcagtgttgtagtaactaa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - RAB3D, member RAS oncogene family
- TIMP metallopeptidase inhibitor 4
- coiled-coil domain containing 34
- RAB7A, member RAS oncogene family

Buy RAB5A-RAB5A, member RAS oncogene family Gene now

Add to cart