RAB7A-RAB7A, member RAS oncogene family Gene View larger

RAB7A-RAB7A, member RAS oncogene family Gene


New product

113,40 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of RAB7A-RAB7A, member RAS oncogene family Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about RAB7A-RAB7A, member RAS oncogene family Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC013728
Product type: DNA & cDNA
Ncbi symbol: RAB7A
Origin species: Human
Product name: RAB7A-RAB7A, member RAS oncogene family Gene
Size: 2ug
Accessions: BC013728
Gene id: 7879
Gene description: RAB7A, member RAS oncogene family
Synonyms: RAB7A, member RAS oncogene family; PRO2706; RAB7; ras-related protein Rab-7a; RAB7, member RAS oncogene family; Ras-associated protein RAB7
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgagtttctcatccaggccagtccccgagatcctgaaaacttcccatttgttgtgttgggaaacaagattgacctcgaaaacagacaagtggccacaaagcgggcacaggcctggtgctacagcaaaaacaacattccctactttgagaccagtgccaaggaggccatcaacgtggagcaggcgttccagacgattgcacggaatgcacttaagcaggaaacggaggtggagctgtacaacgaatttcctgaacctatcaaactggacaagaatgaccgggccaaggcctcggcagaaagctgcagttgctgagggggcagtgagagttgagcacagagtccttcacaaaccaagaacacacgtaggccttcaacacaattcccctctcctcttccaaacaaaacatacattgatctctcacatccagctgccaaaagaaaaccccatcaaacacagttacaccccacatatctctcacacacacacacacacgcacacacacacacacagatctgacgtaatcaaactccagcccttgcccgtgatggctccttggggtctgcctgcccacccacatgagcccgcgagtatggcagcaggacaagccagcggtggaagtcattctgatatggagttggcattggaagcttattctttttgttcactggagagagagagaactgtttacagttaa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - DNA-damage-inducible transcript 4
- tissue factor pathway inhibitor 2
- glutathione S-transferase theta 1
- RAB34, member RAS oncogene family

Buy RAB7A-RAB7A, member RAS oncogene family Gene now

Add to cart