Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
Data sheet of DDIT4-DNA-damage-inducible transcript 4 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about DDIT4-DNA-damage-inducible transcript 4 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC007714 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | DDIT4 |
| Origin species: | Human |
| Product name: | DDIT4-DNA-damage-inducible transcript 4 Gene |
| Size: | 2ug |
| Accessions: | BC007714 |
| Gene id: | 54541 |
| Gene description: | DNA-damage-inducible transcript 4 |
| Synonyms: | Dig2; REDD-1; REDD1; DNA damage-inducible transcript 4 protein; HIF-1 responsive protein RTP801; protein regulated in development and DNA damage response 1; DNA damage inducible transcript 4 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgcctagcctttgggaccgcttctcgtcgtcgtccacctcctcttcgccctcgtccttgccccgaactcccaccccagatcggccgccgcgctcagcctgggggtcggcgacccgggaggaggggtttgaccgctccacgagcctggagagctcggactgcgagtccctggacagcagcaacagtggcttcgggccggaggaagacacggcttacctggatggggtgtcgttgcccgacttcgagctgctcagtgaccctgaggatgaacacttgtgtgccaacctgatgcagctgctgcaggagagcctggcccaggcgcggctgggctctcgacgccctgcgcgcctgctgatgcctagccagttggtaagccaggtgggcaaagaactactgcgcctggcctacagcgagccgtgcggcctgcggggggcgctgctggacgtctgcgtggagcagggcaagagctgccacagcgtgggccagctggcactcgaccccagcctggtgcccaccttccagctgaccctcgtgctgcgcctggactcacgactctggcccaagatccaggggctgtttagctccgccaactctcccttcctccctggcttcagccagtccctgacgctgagcactggcttccgagtcatcaagaagaagctgtacagctcggaacagctgctcattgaggagtgttga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - tissue factor pathway inhibitor 2 - glutathione S-transferase theta 1 - RAB34, member RAS oncogene family - FERM and PDZ domain containing 2 |