GSTT1-glutathione S-transferase theta 1 Gene View larger

GSTT1-glutathione S-transferase theta 1 Gene

PTXBC007065

New product

113,40 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of GSTT1-glutathione S-transferase theta 1 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about GSTT1-glutathione S-transferase theta 1 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC007065
Product type: DNA & cDNA
Ncbi symbol: GSTT1
Origin species: Human
Product name: GSTT1-glutathione S-transferase theta 1 Gene
Size: 2ug
Accessions: BC007065
Gene id: 2952
Gene description: glutathione S-transferase theta 1
Synonyms: glutathione S-transferase theta-1; GST class-theta-1; glutathione transferase T1-1; glutathione S-transferase theta 1
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgggcctggagctgtacctggacctgctgtcccagccctgccgcgctgtttacatctttgccaagaagaacgacattcccttcgagctgcgcatcgtggatctgattaaaggtcagcacttaagcgatgcctgtgcccaggtgaaccccctcaagaaggtgccagccttgaaggacggggacttcaccttgacggagagtgtggccatcctgctctacctgacgcgcaaatataaggtccctgactactggtaccctcaggacctgcaggcccgtgcccgtgtggatgagtacctggcatggcagcacacgactctgcggagaagctgcctccgggccttgtggcataaggtgatgttccctgttttcctgggtgagccagtatctccccagacactggcagccaccctggcagagttggatgtgaccctgcagttgctcgaggacaagttcctccagaacaaggccttccttactggtcctcacatctccttagctgacctcgtagccatcacggagctgatgcatcccgtgggtgctggctgccaagtcttcgaaggccgacccaagctggccacatggcggcagcgcgtggaggcagcagtgggggaggacctcttccaggaggcccatgaggtcattctgaaggccaaggacttcccacctgcagaccccaccataaaacagaagctgatgccctgggtgctggccatgatccggtga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - RAB34, member RAS oncogene family
- FERM and PDZ domain containing 2
- voltage-dependent anion channel 2
- centrosomal protein 170kDa-like

Buy GSTT1-glutathione S-transferase theta 1 Gene now

Add to cart